Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU001041

Sigma-Aldrich

MISSION® esiRNA

targeting human SETD7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGGGGAGATGACTGGAGAGAAGATAGCCTATGTGTACCCTGATGAGAGGACCGCACTTTATGGGAAATTTATTGATGGAGAGATGATAGAAGGCAAACTGGCTACCCTTATGTCCACTGAAGAAGGGAGGCCTCACTTTGAACTGATGCCTGGAAATTCAGTGTACCACTTTGATAAGTCGACTTCATCTTGCATTTCTACCAATGCTCTTCTTCCAGATCCTTATGAATCAGAAAGGGTTTATGTTGCTGAATCTCTTATTTCCAGTGCTGGAGAAGGACTTTTTTCAAAGGTAGCTGTGGGACCTAATACTGTTATGTCTTTTTATAATGGAGTTCGAATTACACACCAAGAGGTTGACAGCAGGGACTGGGCCCTTAATGGGAACACCCTCTCCCTTGATGAAGAAACGGTCATTGATGTGCCTGAGCCCTATAACC

Ensembl | nº de acceso humano

ENSG00000145391

Nº de acceso NCBI

NM_030648

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SETD7(80854) , SETD7(80854)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ORS
JRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chun-Mei Wang et al.
International journal of immunopathology and pharmacology, 30(3), 264-271 (2017-08-02)
Our previous high-throughput sequencing indicated that rno-miR-1298 was down-regulated in ischemia-reperfusion model of rat. However, little is known about the function and molecular mechanism of rno-miR-1298 in rat tumor cell. In this study, rno-miR-1298 was detected to be significantly down-regulated
Shi-Lan Zhang et al.
American journal of translational research, 12(2), 602-611 (2020-03-21)
SET7 is the first lysine methyltransferase and plays vital roles in tumorigenesis. This study aims to seek clinical value of SET7 in colorectal cancer (CRC) patients, along with its biological impact on cell proliferation and migration. In patients with CRC
Yong-Sun Maeng et al.
BMC medical genomics, 8, 74-74 (2015-11-11)
TGFβ1-induced expression of transforming growth factor β-induced protein (TGFBIp) and extracellular matrix (ECM) genes plays a major role in the development of granular corneal dystrophy type 2 (GCD2: also called Avellino corneal dystrophy). Although some key transcription factors are known

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico