Skip to Content
Merck
All Photos(1)

Documents

EHU153501

Sigma-Aldrich

MISSION® esiRNA

targeting human RHBDF2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGTGTACGAGAGCGTGAAGTACATCCAGCAGGAGAACTTCTGGGTTGGCCCCAGCTCGATTGACCTGATCCACCTGGGGGCCAAGTTCTCACCCTGCATCCGGAAGGACGGGCAGATCGAGCAGCTGGTGCTGCGCGAGCGAGACCTGGAGCGGGACTCAGGCTGCTGTGTCCAGAATGACCACTCCGGATGCATCCAGACCCAGCGGAAGGACTGCTCGGAGACTTTGGCCACTTTTGTCAAGTGGCAGGATGACACTGGGCCCCCCATGGACAAGTCTGATCTGGGCCAGAAGCGGACTTCGGGGGCTGTCTGCCACCAGGACCCCAGGACCTGCGAGGAGCCAGCCTCCAGCGGTGCCCACATCTGGCCCGATGACATCACTAAGTGGCCGATCTGCACAGAGCAGGCCAGGAGCAACCACACAGGCTTCCTGCACATGGACTGCGAGATCAAGGGCCGCCCCTGCTGCATCGGCACCAAGGGCAGCTGTGAGATCACCACCCGGGAATACTGTGAGTTCATGCACGGCTATTTCCATGAGGAAGCAACACTCTGCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chen-Xu Ge et al.
Biochemical and biophysical research communications, 493(4), 1402-1409 (2017-10-03)
Accumulating researches reported that particulate matter (PM2.5) is a risk factor for developing various diseases, including metabolic syndrome. Recently, inactive rhomboid protein 2 (iRhom2) was considered as a necessary modulator for shedding of tumor necrosis factor-α (TNF-α) in immune cells.
Cheng Chaohui et al.
Biochemical and biophysical research communications, 503(3), 1897-1904 (2018-08-12)
Atherosclerosis is a complex chronic inflammatory disease that is characterized by the formation of lipid-rich plaques on the inner walls of the arteries. Inactive rhomboid protein 2 (iRhom2) was recently determined as a necessary regulator for the shedding of tumor
Ulrike Künzel et al.
eLife, 7 (2018-06-14)
Many intercellular signals are synthesised as transmembrane precursors that are released by proteolytic cleavage ('shedding') from the cell surface. ADAM17, a membrane-tethered metalloprotease, is the primary shedding enzyme responsible for the release of the inflammatory cytokine TNFα and several EGF

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service