Skip to Content
Merck
All Photos(1)

Key Documents

EHU150691

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A3R2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Select a Size

Change View
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGACAAGGACACTGAGGATGGCAGTGCCTGGAAGCAAGATCCCTTCCAGGAGAGCGGCCTCCACCTGAGCCCCACGGCGGCCGAGAGGAGAAGGCTCGAGCCATGCGAGTCAACAAGCGCGCGCCACAGATGGACTGGAACAGGAAGCGTGAAATCTTCAGCAACTTCTGAGCCCCTTCCTGCCTGTCTCGGGACCCTGGGACCCCTCCCGCACGGACCTTGGGCCTCAGCCTGCCCCGAGCTCCCCCAGCCTCAGTGGACTGGAGGGTGGTCCTGCCATTGCCCAGAAATCAGCCCCAGCCCCGGTGAGCCCCCATCCTGCCCCTGCCCACCAGGTACTGGGGGCCTGTGGCAGCAAGATAGGGGGAGAGAGACCCAGAGATGTGAGAGAGAGTCAGAGACAGAGACAGAGAGAGAGAGAGAGAGACACAGAGAGAGACAGAGAGAGAGCGAGCGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ursula Storch et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(1), E37-E46 (2016-12-21)
The activation mechanism of the classical transient receptor potential channels TRPC4 and -5 via the Gq/11 protein-phospholipase C (PLC) signaling pathway has remained elusive so far. In contrast to all other TRPC channels, the PLC product diacylglycerol (DAG) is not
Ivan Meneses-Morales et al.
Nucleic acids research, 42(11), 6885-6900 (2014-04-29)
The estrogen receptor alpha (ERα) is a ligand-activated transcription factor that possesses two activating domains designated AF-1 and AF-2 that mediate its transcriptional activity. The role of AF-2 is to recruit coregulator protein complexes capable of modifying chromatin condensation status.

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service