Skip to Content
Merck
All Photos(1)

Key Documents

EHU138931

Sigma-Aldrich

MISSION® esiRNA

targeting human GALR2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Estimated to ship onMarch 27, 2025



Select a Size

Change View
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

MXP 5,935.00


Estimated to ship onMarch 27, 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACCATCTACACCCTGGACGGCTGGGTGTTCGGCTCGCTGCTGTGCAAGGCGGTGCACTTCCTCATCTTCCTCACCATGCACGCCAGCAGCTTCACGCTGGCCGCCGTCTCCCTGGACAGGTATCTGGCCATCCGCTACCCGCTGCACTCCCGCGAGCTGCGCACGCCTCGAAACGCGCTGGCAGCCATCGGGCTCATCTGGGGGCTGTCGCTGCTCTTCTCCGGGCCCTACCTGAGCTACTACCGCCAGTCGCAGCTGGCCAACCTGACCGTGTGCCATCCCGCGTGGAGCGCCCCTCGCCGCCGCGCCATGGACATCTGCACCTTCGTCTTCAGCTACCTGCTTCCTGTGCTGGTTCTCGGCCTGACCTACGCGCGCACCTTGCGCTACCTCTGGCGCGCCGTCGACCCGGTGGCCGCGGGCTCGGGTGCCCGGCGCGCCAAGCGCAAGGTGACACGCATGATCCTCATCGTGGCCGCGCTCTTCTGCCTCTGCTGGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Manuel Narváez et al.
Frontiers in cellular neuroscience, 12, 119-119 (2018-05-17)
Anxiety is evoked by a threatening situation and display adaptive or defensive behaviors, found similarly in animals and humans. Neuropeptide Y (NPY) Y1 receptor (NPYY1R) and Galanin (GAL) receptor 2 (GALR2) interact in several regions of the limbic system, including
Antonio Flores-Burgess et al.
Neuropharmacology, 118, 233-241 (2017-03-16)
The pharmacological treatment of major depression is mainly based on drugs elevating serotonergic (5-HT) activity. Specifically, selective 5-HT reuptake inhibitors, including Fluoxetine (FLX), are the most commonly used for treatment of major depression. However, the understanding of the mechanism of

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service