Skip to Content
Merck
All Photos(1)

Key Documents

EHU044501

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53INP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCCAACTAAAGACAAGGTTTTGAAATCTCAGCTATAAAAGACATCCAGCCAAACTCTCAGTCTTGCCTTAACAATGTTCCAGAGGCTGAATAAAATGTTTGTGGGTGAAGTCAGTTCTTCCTCCAACCAAGAACCAGAATTCAATGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACTTGCACTGGTTTCTCAGCAGAAGAAGAAGAAGAAGAGGAGGACATCAGTGAAGAGTCACCTACTGAGCACCCTTCAGTCTTTTCCTGTTTACCGGCATCTCTTGAGTGCTTGGCTGATACAAGTGATTCCTGCTTTCTCCAGTTTGAGTCATGTCCAATGGAGGAGAGCTGGTTTATCACCCCACCCCCATGTTTTACTGCAGGTGGATTAACCACTATCAAGGTGGAAACAAGTCCTATGGAAAACCTTCTCATTGAACATCCCAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yonggang Huang et al.
Journal of Cancer, 11(22), 6545-6555 (2020-10-14)
Liver tumor-initiating cells (T-ICs) contribute to tumorigenesis, progression, recurrence and drug resistance of hepatocellular carcinoma (HCC). However, the underlying mechanism for the propagation of liver T-ICs remains unclear. In the present study, our finding shows that miR-96 is upregulated in
Xiaohuan Xia et al.
Stem cell research & therapy, 10(1), 282-282 (2019-09-25)
Recent studies suggested that miR-17~106 family was involved in the regulation of neural stem/progenitor cells (NPCs). However, distinct function of each family member was reported in regulating stem cells within and without the brain. Hence, to investigate the roles of
Mingming Zhu et al.
Cancer medicine, 9(22), 8639-8649 (2020-09-29)
Recently, long noncoding RNAs (lncRNAs) were recognized as significant therapeutic targets in tumors. Our previous microarray analysis showed that lncRNA TCONS_000026334 expression was reduced in metastatic colorectal cancer (CRC) tissues. The objective of this study was to research the biological

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service