Skip to Content
Merck
All Photos(1)

Key Documents

EHU112501

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPB1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCCCTGGATGTCAACCACTTCGCCCCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATCACCGGCAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCCCGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCCACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTGGAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACCATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCCAGAAGCTGCAAAATCCGATGAGACTGCCGCCAAGTAAAGCCTTAGCCCGGATGCCCACCCCTGCTGCCGCCACTGGCTGTGCCTCCCCCGCCACCTGTGTGTTCTTTTGATACATTTATCTTCTGTTTTTCTCAAATAAAGTTCAAAGCAACCA

Ensembl | human accession no.

ENSG00000106211

NCBI accession no.

NM_001540

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HSPB1(3315) , HSPB1(3315)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
EDV
TRU
EZT
YXT
TWT

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eva Hadadi et al.
Scientific reports, 6, 39035-39035 (2016-12-16)
Monocytes play a central role in regulating inflammation in response to infection or injury, and during auto-inflammatory diseases. Human blood contains classical, intermediate and non-classical monocyte subsets that each express characteristic patterns of cell surface CD16 and CD14; each subset
Ah-Mee Park et al.
PloS one, 11(2), e0148998-e0148998 (2016-02-10)
Heat shock protein 27 (HSP27) is a member of the small molecular weight HSP family. Upon treatment with transforming growth factor β1 (TGF-β1), we observed upregulation of HSP27 along with that of α-smooth muscle actin (α-SMA), a marker of myofibroblast
Julia Ketteler et al.
Cell death & disease, 11(4), 228-228 (2020-04-11)
The integral membrane protein caveolin-1 (CAV1) plays a central role in radioresistance-mediating tumor-stroma interactions of advanced prostate cancer (PCa). Among the tumor-stroma, endothelial cells (EC) evolved as critical determinants of the radiation response. CAV1 deficiency in angiogenic EC was already
Hiroaki Inaba et al.
Infection and immunity, 86(4) (2018-01-18)
Porphyromonas gingivalis, a periodontal pathogen, has been implicated as a causative agent of preterm delivery of low-birth-weight infants. We previously reported that P. gingivalis activated cellular DNA damage signaling pathways and ERK1/2 that lead to G1 arrest and apoptosis in
Kun Guo et al.
BMC cancer, 9, 100-100 (2009-04-01)
During the process of metastasis, cells are subjected to various apoptotic stimuli. Aberrant expression of apoptotic regulators often contribute to cell metastasis. Heat shock protein 27(HSP27) is confirmed as an apoptosis regulator, but its antiapoptotic mechanism in metastatic hepatocellular carcinoma
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service