Skip to Content
Merck
All Photos(1)

Documents

EHU075591

Sigma-Aldrich

MISSION® esiRNA

targeting human RAC1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTGTTGTGCCGAGAACACCGAGCACTGAACTTTGCAAAGACCTTCGTCTTTGAGAAGACGGTAGCTTCTGCAGTTAGGAGGTGCAGACACTTGCTCTCCTATGTAGTTCTCAGATGCGTAAAGCAGAACAGCCTCCCGAATGAAGCGTTGCCATTGAACTCACCAGTGAGTTAGCAGCACGTGTTCCCGACATAACATTGTACTGTAATGGAGTGAGCGTAGCAGCTCAGCTCTTTGGATCAGTCTTTGTGATTTCATAGCGAGTTTTCTGACCAGCTTTTGCGGAGATTTTGAACAGAACTGCTATTTCCTCTAATGAAGAATTCTGTTTAGCTGTGGGTGTGCCGGGTGGGGTGTGTGTGATCAAAGGACAAAGACAGTATTTTGACAAAATACGAAGTGGAGATTTACACTACATTGTACAAGGAATGAAAGTGTCACGGG

Ensembl | human accession no.

ENSG00000136238

NCBI accession no.

NM_018890

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAC1(5879) , RAC1(5879)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anika Zilch et al.
Medical microbiology and immunology, 207(3-4), 227-242 (2018-04-28)
The human cytomegalovirus (HCMV) is a common pathogen, which causes severe or even deadly diseases in immunocompromised patients. In addition, congenital HCMV infection represents a major health concern affecting especially the lung tissue of the susceptible individuals. Antivirals are a
Karina Graber et al.
Virus research, 276, 197835-197835 (2019-12-11)
Infections with the herpes simplex virus type 1 (HSV-1) are common and widespread. Most infections remain undetected but severe forms may develop in newborns and in immunocompromised patients. Moreover, HSV-1 might be involved in the pathogenesis of atherosclerosis, which may
Ha Linh Vu et al.
Pigment cell & melanoma research, 28(5), 590-598 (2015-07-16)
Whole exome sequencing of cutaneous melanoma has led to the detection of P29 mutations in RAC1 in 5-9% of samples, but the role of RAC1 P29 mutations in melanoma biology remains unclear. Using reverse phase protein array analysis to examine
Hongxue Shi et al.
International journal of biological sciences, 11(7), 845-859 (2015-06-17)
Fibroblasts play a pivotal role in the process of cutaneous wound repair, whereas their migratory ability under diabetic conditions is markedly reduced. In this study, we investigated the effect of basic fibroblast growth factor (bFGF) on human dermal fibroblast migration
S Skvortsov et al.
British journal of cancer, 110(11), 2677-2687 (2014-05-03)
In order to improve therapy for HNSCC patients, novel methods to predict and combat local and/or distant tumour relapses are urgently needed. This study has been dedicated to the hypothesis that Rac1, a Rho GTPase, is implicated in HNSCC insensitivity
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service