Skip to Content
Merck
All Photos(1)

Key Documents

EHU036101

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGACCAGAACTGGCAGGAAGCTGCACTTGGGAGTGATGATTCCAAGGCTACCATGCTATTCTTCCACTTCTTGGATCAGCTGAACTATGAGTGTGGCCGTTGCAGCCAGGACCCAGAGTCCTTGTTGCTGCAGCACAATTTGCGGAAATTCTGCCGGGACATTCAGCCCTTTTCCCAGGATCCTACCCAGTTGGCTGAGATGATCTTTAACCTCCTTCTGGAAGAAAAAAGAATTTTGATCCAGGCTCAGAGGGCCCAATTGGAACAAGGAGAGCCAGTTCTCGAAACACCTGTGGAGAGCCAGCAACATGAGATTGAATCCCGGATCCTGGATTTAAGGGCTATGATGGAGAAGCTGGTAAAATCCATCAGCCAACTGAAAGACCAGCAGGATGTCTTCTGCTTCCGA

Ensembl | human accession no.

ENSG00000170581

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STAT2(6773) , STAT2(6773)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Katherine R Walter et al.
Oncoimmunology, 9(1), 1758547-1758547 (2020-05-12)
Type I (IFNα/β) interferon signaling represents a critical transduction pathway involved in recognition and destruction of nascent tumor cells. Downregulation of this pathway to promote a more immunosuppressed microenvironment contributes to the ability of tumor cells to evade the immune
Guanming Wang et al.
The Journal of biological chemistry, 294(50), 18969-18979 (2019-10-17)
Cytoplasmic dsRNA is recognized by RNA helicase RIG-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5), triggering induction of the innate immune response via the mitochondrial antiviral signaling protein (MAVS). In contrast, extracellular dsRNA is internalized into endosomes and recognized by
Adriana Forero et al.
Immunity, 51(3), 451-464 (2019-09-01)
Type I and III interferons (IFNs) activate similar downstream signaling cascades, but unlike type I IFNs, type III IFNs (IFNλ) do not elicit strong inflammatory responses in vivo. Here, we examined the molecular mechanisms underlying this disparity. Type I and III

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service