Skip to Content
Merck

73035AST

Supelco

Astec® CHIRALDEX G-TA Capillary GC Column

L × I.D. 50 m × 0.25 mm, df 0.12 μm

Synonym(s):

GC column, chiral, gamma-dextran

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41115710
NACRES:
SB.54

Pricing and availability is not currently available.

material

fused silica

Quality Level

description

GC capillary column

packaging

pkg of 1 ea

parameter

-10-180 °C temperature (isothermal or programmed)

Beta value

500

df

0.12 μm

technique(s)

gas chromatography (GC): suitable

L × I.D.

50 m × 0.25 mm

matrix active group

non-bonded; 2,6-di-O-pentyl-3-trifluoroacetyl derivative of γ-cyclodextrin phase

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU094301EHU015691EHU022371
Gene Information

human ... STBD1(100631383), STBD1(8987)

Gene Information

human ... SCEL(8796), SCEL(8796)

Gene Information

human ... ZBTB17(7709), ZBTB17(7709)

Gene Information

human ... BTBD1(53339), BTBD1(53339)

Ensembl | human accession no.

ENSG00000118804

Ensembl | human accession no.

ENSG00000136155

Ensembl | human accession no.

ENSG00000116809

Ensembl | human accession no.

ENSG00000064726

esiRNA cDNA target sequence

CCTTCCAGGGAAGTCTGTGACAATTCAAGAGAACATGTTCCTTCTGGACAGTTTCCAGACACAGAAGCTCCAGCTACCTCTGAGACCAGTAACTCTAGGAGTTACTCTGAAGTTTCAAGAAATGAAAGCCTTGAATCTCCTATGGGAGAATGGGGATTCCAAAAAGGACAAGAGATATCTGCTAAAGCAGCTACATGTTTTGCAGAGAAGTTGCCTTCTAGCAACCTGCTCAAGAACAGAGCTAAAGAAGAAATGAGCCTCTCTGATTTGAACAGTCAGGACCGGGTTGACCACGAGGAGTGGGAAATGGTGCCTAGGCACTCATCTTGGGGGGATGTTGGTGTGGGTGGCAGTCTTAAGGCTCCAGTGTTAAACCTAAACCAGGGAATGGACAATGGAAGAAGCACTTTGGTGGAAGCAAGAGGTCAGCAAG

esiRNA cDNA target sequence

CTCATCAAGGTGAATCCTGAAATTTTCACAAACAACCAAAGAAACCAAGATCTTGCTAACCTCATCAAAGTAAATCCTGCAGTAATCAGAAACAATCAGAGCCAAGACTTGGACAATCTTATTAAAGTGAAACCTTCAGCTCTTAGAAACACTAATCGAGACCAGAACCTGGAAAATTTAATTGAAGTAAATTCTCATGTGTCTGAAAACAAGAATGGAAGCTCTAACACTGGAGCCAAGCAGGCAGGACCACAGGATACTGTTGTGTACACAAGGACATATGTGGAGAATAGTAAATCACCCAAGGATGGATATCAGGAGAATATCTCTGGAAAATACATACAAACTGTTTATTCAACTTCTGATAGGTCTGTCATTGAAAGAGATATGTGCACTTACTGCCGAAAACCCTTGGGTGTAGA

esiRNA cDNA target sequence

GGCTGTCTGGAAATCTGAGCCATGGACTTTCCCCAGCACAGCCAGCATGTCTTGGAACAGCTGAACCAGCAGCGGCAGCTGGGGCTTCTCTGTGACTGCACCTTTGTGGTGGACGGTGTTCACTTTAAGGCTCATAAAGCAGTGCTGGCGGCCTGCAGCGAGTACTTCAAGATGCTCTTCGTGGACCAGAAGGACGTGGTGCACCTGGACATCAGTAACGCGGCAGGCCTGGGGCAGGTGCTGGAGTTTATGTACACGGCCAAGCTGAGCCTGAGCCCTGAGAACGTGGATGATGTGCTGGCCGTGGCCACTTTCCTCCAAATGCAGGACATCATCACGGCCTGCCATGCCCTCAAGTCACTTGCTGAGCCGGCTACCAGCCCTGGGGGAAATGCGGAGGCCTTGGCCACAGAAGGAGGGGACAAGA

esiRNA cDNA target sequence

CCCTAAACCCCGAGTTGAATACATTGACCGACCAAGATGCTGTCTCAGGGGAAAGGAATGCTGCATCAATAGATTCCAGCAAGTAGAAAGCCGCTGGGGTTACAGTGGGACGAGTGATCGAATCAGATTCACAGTTAATAGAAGGATCTCTATAGTTGGATTTGGCTTGTATGGATCTATTCATGGCCCTACAGATTATCAAGTGAATATACAGATCATTGAATATGAGAAAAAGCAAACCCTGGGACAGAATGATACCGGCTTTAGTTGTGATGGGACAGCTAACACATTCAGGGTCATGTTCAAGGAACCCATAGAGATCCTGCCCAATGTGTGCTACACAGCATGTGCAACACTCAAAGGTCCAGATTCCCACTATGGCACAAAAGGATTGAAGAAAGTAGTGCATGAGACACCTGCTG

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

Astec® CHIRALDEX G-TA is the first choice in the Group 1 CSPs (Surface Interactions, Complex Derivatives). This phase has been shown to be the most broadly-selective phase for the pharmaceutical industry, especially for the analysis of chiral intermediates and drug studies in various stages of clinical trials. Separations occur without the inclusion mechanism and are typically faster and more efficient than most chiral stationary phases. G-TA has also been used to separate parent drug enantiomers and their metabolites. G-TA has its highest selectivity for oxygen-containing analytes like alcohols, diols and polyols as the free alcohol and as an acyl derivative; amines as acyl derivatives; amino alcohols, halogens (Cl>Br>F), amino acids, hydroxy acids, lactones, furans and pyrans. It is also highly selective for halogenated compounds.

Application


  • Enantioselective gas chromatographic analysis of aqueous samples by on-line derivatisation. Application to enzymatic reactions.: This study explores the use of the Astec CHIRALDEX G-TA Capillary GC Column for enantioselective gas chromatographic analysis. The method involves on-line derivatization, enabling the analysis of aqueous samples and applying this technique to enzymatic reactions. This innovative approach highlights the column′s capability in achieving high selectivity and sensitivity for chiral compounds in complex matrices (Mommers et al., 2008).

Chem/Phys Resistance

Temp. Limits:
  • -10 °C to 180 °C isothermal and programmed

Other Notes

We offer a variety of chromatography accessories including analytical syringes

Legal Information

Astec is a registered trademark of Merck KGaA, Darmstadt, Germany
CHIRALDEX is a trademark of Sigma-Aldrich Co. LLC

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Asymmetric ring opening of meso-epoxides with B-halobis(2-isocaranyl)boranes 2-dIcr2BX
Roy, Chandra D., Brown, Herbert C.
Tetrahedron Asymmetry, 17 (13), 1931-1936 (2006)
Kinetic resolutions concentrate the minor enantiomer and aid measurement of high enantiomeric purity.
Caron, Gaetan; Tseng, George W.M.; Kazlauskas, R.J.
Tetrahedron Asymmetry, 5 (1), 83-92 (1994)
Hugo L van Beek et al.
FEBS open bio, 4, 168-174 (2014-03-22)
Enzyme stability is an important parameter in biocatalytic applications, and there is a strong need for efficient methods to generate robust enzymes. We investigated whether stabilizing disulfide bonds can be computationally designed based on a model structure. In our approach
Investigation of a novel diamine based chiral auxiliary in the asymmetric alkylation of ketones
Clarke, Sarah L, et al.
Tetrahedron Asymmetry, 25 (4), 356-361 (2014)
Asymmetric epoxidation catalyzed by esters of a-hydroxy-8-oxabicyclo[3.2.1]octan-3-one
Armstrong, A., et al.
Tetrahedron Asymmetry, 12 (20), 2779-2781 (2001)

Articles

Chromatographic enantiomeric separation of amino acids, like proline, is described for chiral GC analysis after derivatization.

Chromatographic enantiomeric separation of amino acids, like proline, is described for chiral GC analysis after derivatization.

Chromatographic enantiomeric separation of amino acids, like proline, is described for chiral GC analysis after derivatization.

Chromatographic enantiomeric separation of amino acids, like proline, is described for chiral GC analysis after derivatization.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service