Skip to Content
Merck
All Photos(1)

Key Documents

EMU014681

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ezh2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTTCAGAGGGAGCAAAGCTTGCATTCATTTCATACGCTCTTCTGTCGACGATGTTTTAAGTATGACTGCTTCCTACATCCCTTCCATGCAACACCCAACACATATAAGAGGAAGAACACAGAAACAGCTTTGGACAACAAGCCTTGTGGACCACAGTGTTACCAGCATCTGGAGGGAGCTAAGGAGTTTGCTGCTGCTCTTACTGCTGAGCGTATAAAGACACCACCTAAACGCCCAGGGGGGCGCAGAAGAGGAAGACTTCCGAATAACAGTAGCAGACCCAGCACCCCCACCATCAGTGTGCTGGAGTCAAAGGATACAGACAGTGACAGAGAAGCAGGGACTGAAACTGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAAAAAGATGAGACGTCCAGCTCCTCTGAAGCAAATTCTCGG

Ensembl | mouse accession no.

ENSMUSG00000029687

NCBI accession no.

NM_001146689

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... EZH2(14056) , Ezh2(14056)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

B C Roy et al.
Oncogene, 34(34), 4519-4530 (2014-12-09)
The enhancer of zeste homolog-2 (EZH2) represses gene transcription through histone H3 lysine-27-trimethylation (H3K27me3). Citrobacter rodentium (CR) promotes crypt hyperplasia and tumorigenesis by aberrantly regulating Wnt/β-catenin signaling. We aimed at investigating EZH2's role in epigenetically regulating Wnt/β-catenin signaling following bacterial
Lu Lu et al.
Toxicology and applied pharmacology, 289(2), 276-285 (2015-09-30)
Lung cancer is regarded as the leading cause of cancer-related deaths, and cigarette smoking is one of the strongest risk factors for the development of lung cancer. However, the mechanisms for cigarette smoke-induced lung carcinogenesis remain unclear. The present study
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of
Ying Qi et al.
Molecular bioSystems, 11(7), 1980-1986 (2015-05-08)
A histone methyltransferase enhancer of zeste homologue 2 (EZH2) catalyzes trimethylation at histone H3 lysine27 (H3K27me3) and is frequently dysregulated in a wide range of human cancers. EZH2-mediated gene silencing contributes to carcinogenesis and regulates stem cell maintenance and differentiation;
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service