Skip to Content
Merck
All Photos(1)

Key Documents

EHU150611

Sigma-Aldrich

MISSION® esiRNA

targeting human FAM83H

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGTACAGCAGCAACCTTCGGGATGACACGAAGGCCATTCTGGAGCAGATCAGTGCCCACGGCCAGAAGCACCGTGCGGTCCCTGCCCCGAGCCCCGGCCCGACCCACAACAGCCCCGAGCTAGGCCGTCCACCGGCTGCTGGCGTCCTGGCCCCAGATATGTCCGACAAGGACAAGTGTTCAGCCATCTTCCGCTCGGACAGCTTGGGGACCCAGGGCCGGCTGAGCCGCACGCTGCCAGCCAGCGCGGAGGAGCGCGATCGGCTGCTGCGCCGCATGGAGAGCATGCGCAAGGAGAAGCGCGTGTACAGCCGCTTCGAGGTCTTCTGCAAGAAAGAGGAGGCCAGCAGCCCTGGGGCAGGGGAAGGCCCCGCGGAGGAGGGCACCAGGGACAGCAAGGTGGGCAAGTTCGTGCCCAAGATCCTGGGCACGTTCAAAAGCAAGAAGTGAGTCTTCTGGCCTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sung Woo Ahn et al.
Diagnostic pathology, 15(1), 63-63 (2020-05-29)
Recently, FAM83H was reported to have roles in cancer progression in conjunction with oncogenic molecules such as MYC and b-catenin. Moreover, the data from the public database indicates a molecular relationship between FAM83H and zinc finger proteins, especially between FAM83H
Usama Khamis Hussein et al.
Aging, 12(12), 11812-11834 (2020-06-22)
FAM83H primarily is known for its function in tooth development. Recently, a role for FAM83H in tumorigenesis, conjunction with MYC and β-catenin, has been suggested. Analysis of public data indicates that FAM83H expression is closely associated with SCRIB expression in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service