Skip to Content
Merck
All Photos(1)

Key Documents

EHU131361

Sigma-Aldrich

MISSION® esiRNA

targeting human ITLN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACAGCTCCCTGCTGAGGTACCGCACGGACACTGGCTTCCTCCAGACACTGGGACATAATCTGTTTGGCATCTACCAGAAATATCCAGTGAAATATGGAGAAGGAAAGTGTTGGACTGACAACGGCCCGGTGATCCCTGTGGTCTATGATTTTGGCGACGCCCAGAAAACAGCATCTTATTACTCACCCTATGGCCAGCGGGAATTCACTGCGGGATTTGTTCAGTTCAGGGTATTTAATAACGAGAGAGCAGCCAACGCCTTGTGTGCTGGAATGAGGGTCACCGGATGTAACACTGAGCACCACTGCATTGGTGGAGGAGGATACTTTCCAGAGGCCAGTCCCCAGCAGTGTGGAGATTTTTCTGGTTTTGATTGGAGTGGATATGGAACTCATGTTGGTTACAGCAGCAGCCGTGAGATAACTGAGGCAGCTGTGCTTCTATTCTATCGTTGAGAGTTTTGTGGGAGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

L Yi et al.
Mucosal immunology, 10(6), 1491-1503 (2017-02-23)
The epithelial and epidermal innate cytokines IL-25, IL-33, and thymic stromal lymphopoietin (TSLP) have pivotal roles in the initiation of allergic inflammation in asthma and atopic dermatitis (AD). However, the mechanism by which the expression of these innate cytokines is
Narutaka Katsuya et al.
Pathology international, 70(12), 943-952 (2020-10-02)
Intelectin-1 (ITLN1) is an adipokine with an anti-inflammatory function that is involved in neoplastic diseases such as pleural mesothelioma and gastric and prostate cancers. However, the expression and function of ITLN1 in colorectal cancer (CRC) remain unknown. To identify novel
Dan Li et al.
Oncotarget, 6(18), 16168-16182 (2015-05-13)
Recent evidence shows the emerging roles of intelectin 1 (ITLN1), a secretory lectin, in human cancers. Our previous studies have implicated the potential roles of ITLN1 in the aggressiveness of gastric cancer. Herein, we investigated the functions, downstream targets, and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service