Skip to Content
Merck
All Photos(1)

Documents

EHU122941

Sigma-Aldrich

MISSION® esiRNA

targeting human PTHLH

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGACTGGTTCAGCAGTGGAGCGTCGCGGTGTTCCTGCTGAGCTACGCGGTGCCCTCCTGCGGGCGCTCGGTGGAGGGTCTCAGCCGCCGCCTCAAAAGAGCTGTGTCTGAACATCAGCTCCTCCATGACAAGGGGAAGTCCATCCAAGATTTACGGCGACGATTCTTCCTTCACCATCTGATCGCAGAAATCCACACAGCTGAAATCAGAGCTACCTCGGAGGTGTCCCCTAACTCCAAGCCCTCTCCCAACACAAAGAACCACCCCGTCCGATTTGGGTCTGATGATGAGGGCAGATACCTAACTCAGGAAACTAACAAGGTGGAGACGTACAAAGAGCAGCCGCTCAAGACACCTGGGAAGAAAAAGAAAGGCAAGCCCGGGAAACGCAAGGAGCAGGAAAAGAAAAAACGGCGAACTCGCTCTGCCTGGTTAGACTCTGGAGTGACTGGGAGTGGGCTAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pengfei Liu et al.
Life sciences, 230, 45-54 (2019-05-28)
The action of cell-based therapy against acute kidney injury (AKI) has been demonstrated by different groups for years. However, which kind of cells hold best therapeutic effect remains unclear. In this study, we mainly explored whether human placental trophoblast cells
Jen-Yu Hung et al.
International journal of oncology, 46(5), 1985-1993 (2015-03-05)
This is the first study to demonstrate that benzo(a)-pyrene (BaP) was able to enhance the production of parathyroid hormone‑related protein (PTHrP) by human non‑small cell lung cancer H460 cells. Such effect would further contribute to bone metastasis of lung cancer
María Mar Roca-Rodríguez et al.
The Journal of clinical endocrinology and metabolism, 100(6), E826-E835 (2015-04-18)
This study aimed to define the potential role of PTHrP on adipogenic regulation and to analyze its relationship with obesity and insulin resistance. This was a cross-sectional study in which visceral (VAT) and subcutaneous (SAT) adipose tissue were extracted from

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service