Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU113021

Sigma-Aldrich

MISSION® esiRNA

targeting human YAP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTTCTCCCGGGATGTCTCAGGAATTGAGAACAATGACGACCAATAGCTCAGATCCTTTCCTTAACAGTGGCACCTATCACTCTCGAGATGAGAGTACAGACAGTGGACTAAGCATGAGCAGCTACAGTGTCCCTCGAACCCCAGATGACTTCCTGAACAGTGTGGATGAGATGGATACAGGTGATACTATCAACCAAAGCACCCTGCCCTCACAGCAGAACCGTTTCCCAGACTACCTTGAAGCCATTCCTGGGACAAATGTGGACCTTGGAACACTGGAAGGAGATGGAATGAACATAGAAGGAGAGGAGCTGATGCCAAGTCTGCAGGAAGCTTTGAGTTCTGACATCCTTAATGACATGGAGTCTGTTTTGGCTGCCACCAAGCTAGATAAAGAAAGCTTTCTTACATGGTTATAGAGCCCTCAGGCAGACTGAATTCTAAATCTGTGAAGGATCTAAGGAGACACATGCACCGGAAATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Akira Takaguri et al.
European journal of pharmacology, 815, 470-477 (2017-09-28)
Apoptosis of vascular smooth muscle cells (VSMCs) has been implicated in the progression of atherosclerosis, especially in vascular remodelling and plaque rupture. Although it is known that Yes-associated protein 1 (YAP1) is a critical molecule that regulates cell proliferation, differentiation
Marcel Trautmann et al.
EMBO molecular medicine, 11(5) (2019-03-23)
Myxoid liposarcomas (MLS), malignant tumors of adipocyte origin, are driven by the FUS-DDIT3 fusion gene encoding an aberrant transcription factor. The mechanisms whereby FUS-DDIT3 mediates sarcomagenesis are incompletely understood, and strategies to selectively target MLS cells remain elusive. Here we
Xiaojian Zhu et al.
Journal of experimental & clinical cancer research : CR, 39(1), 207-207 (2020-10-08)
Accumulating evidence indicates that long non-coding RNAs (lncRNAs) acting as crucial regulators in tumorigenesis. However, its biological functions of lncRNAs in colorectal cancer (CRC) have not been systematically clarified. An unbiased screening was performed to identify disregulated lncRNAs revealed to
Takahiro Tsuji et al.
Nature communications, 11(1), 74-74 (2020-01-05)
Despite the promising clinical efficacy of the second-generation anaplastic lymphoma kinase (ALK) inhibitor alectinib in patients with ALK-rearranged lung cancer, some tumor cells survive and eventually relapse, which may be an obstacle to achieving a cure. Limited information is currently available
Xinliang Jiang et al.
Experimental cell research, 399(1), 112439-112439 (2020-12-29)
Yes-associated protein 1 (YAP1), a co-transcription activator, shuttles between the cytoplasm and the nucleus. Phosphorylation by large tumor suppressor kinases (LATS1/2) is the major determinant of YAP1 subcellular localization. Unphosphorylated YAP1 interacts with transcription factors in the nucleus and regulates

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service