Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU106761

Sigma-Aldrich

MISSION® esiRNA

targeting human STUB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATCTGCAGCGAGCTTACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGAATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAGCTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGCCAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATTGAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAGAAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATGCGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCACCTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTCATCCCCAACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qasim A Khan et al.
PloS one, 13(7), e0199699-e0199699 (2018-07-07)
ALDH1L1 is a folate-metabolizing enzyme abundant in liver and several other tissues. In human cancers and cell lines derived from malignant tumors, the ALDH1L1 gene is commonly silenced through the promoter methylation. It was suggested that ALDH1L1 limits proliferation capacity
Pengfei Zhang et al.
Cell death and differentiation, 27(11), 3177-3195 (2020-06-03)
Ovarian tumour domain-containing protein 3 (OTUD3), a key OTU (ovarian tumour protease) family deubiquitylase, plays context-dependent roles in cancers. It suppresses tumorigenesis in breast, colon, liver and cervical cancer through stabilizing PTEN (phosphatase and tension homologue deleted on chromosome 10)
Jian Wang et al.
Oncotarget, 7(49), 81377-81388 (2016-11-12)
The androgen receptor (AR) is not only a ligand-dependent transcription factor, but also functions as a licensing factor, a component of DNA replication, which is degraded during mitosis. Furthermore, the deregulation of AR activity is involved in the initiation of
Tao Xu et al.
American journal of cancer research, 7(2), 289-300 (2017-03-25)
Glioblastoma (GBM) is the most frequent, aggressive and fatal tumor in the central nervous system, while PTEN signaling is frequently deregulated in human GBM. We previously reported the up-regulation of the carboxyl terminal of Hsp70-interacting protein (CHIP) in GBM, however
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service