Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU013561

Sigma-Aldrich

MISSION® esiRNA

targeting human MSH2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCATGGCTGAAATGTTGGAAACTGCTTCTATCCTCAGGTCTGCAACCAAAGATTCATTAATAATCATAGATGAATTGGGAAGAGGAACTTCTACCTACGATGGATTTGGGTTAGCATGGGCTATATCAGAATACATTGCAACAAAGATTGGTGCTTTTTGCATGTTTGCAACCCATTTTCATGAACTTACTGCCTTGGCCAATCAGATACCAACTGTTAATAATCTACATGTCACAGCACTCACCACTGAAGAGACCTTAACTATGCTTTATCAGGTGAAGAAAGGTGTCTGTGATCAAAGTTTTGGGATTCATGTTGCAGAGCTTGCTAATTTCCCTAAGCATGTAATAGAGTGTGCTAAACAGAAAGCCCTGGAACTTGAGGAGTTTCAGTATATTGGAGAATCGCAAGGATATGATATCATGGAACCAGCAGCAAAGAAGTGCTATCTGGAAAGAGAGCAAGGTGAAAAAATTATTCAGGAGTTCCTGTCCAAGGTGAAACAAATGCCCT

Ensembl | human accession no.

ENSG00000095002

NCBI accession no.

NM_000251

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MSH2(4436) , MSH2(4436)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jennifer A McKinney et al.
Nature communications, 11(1), 236-236 (2020-01-15)
Alternative DNA structure-forming sequences can stimulate mutagenesis and are enriched at mutation hotspots in human cancer genomes, implicating them in disease etiology. However, the mechanisms involved are not well characterized. Here, we discover that Z-DNA is mutagenic in yeast as
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service