Skip to Content
Merck
All Photos(1)

Key Documents

EHU048411

Sigma-Aldrich

MISSION® esiRNA

targeting human WRN

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCACGGAGGGTTTCTATCTTACTAAAGGATATTTCAGAAAATCTATATTCACTGAGGAGGATGATAATTGGGTCTACTAACATTGAGACTGAACTGAGGCCCAGCAATAATTTAAACTTATTATCCTTTGAAGATTCAACTACTGGGGGAGTACAACAGAAACAAATTAGAGAACATGAAGTTTTAATTCACGTTGAAGATGAAACATGGGACCCAACACTTGATCATTTAGCTAAACATGATGGAGAAGATGTACTTGGAAATAAAGTGGAACGAAAAGAAGATGGATTTGAAGATGGAGTAGAAGACAACAAATTGAAAGAGAATATGGAAAGAGCTTGTTTGATGTCGTTAGATATTACAGAACATGAACTCCAAATTTTGGAACAGCAGTCTCAGGA

Ensembl | human accession no.

ENSG00000165392

NCBI accession no.

NM_000553

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... WRN(7486) , WRN(7486)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Niek van Wietmarschen et al.
Nature, 586(7828), 292-298 (2020-10-02)
The RecQ DNA helicase WRN is a synthetic lethal target for cancer cells with microsatellite instability (MSI), a form of genetic hypermutability that arises from impaired mismatch repair1-4. Depletion of WRN induces widespread DNA double-strand breaks in MSI cells, leading
Jyotirindra Maity et al.
DNA repair, 68, 1-11 (2018-05-26)
Impaired autophagy may be associated with normal and pathological aging. Here we explore a link between autophagy and domain function of Werner protein (WRNp). Werner (WRN) mutant cell lines AG11395, AG05229 and normal aged fibroblast AG13129 display a deficient response
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Edmond M Chan et al.
Nature, 568(7753), 551-556 (2019-04-12)
Synthetic lethality-an interaction between two genetic events through which the co-occurrence of these two genetic events leads to cell death, but each event alone does not-can be exploited for cancer therapeutics1. DNA repair processes represent attractive synthetic lethal targets, because
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service