Skip to Content
Merck
All Photos(1)

Key Documents

EHU159061

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACTGGGGCAACCTTTTCTTCGCCTCTGCCTTTGCCTTCCTGGGGCTCTTGGCGCTGACAGTCACCTTTTCCTGCAACCTGGCCACCATTAAGGCCCTGGTGTCCCGCTGCCGGGCCAAGGCCACGGCATCTCAGTCCAGTGCCCAGTGGGGCCGCATCACGACCGAGACGGCCATTCAGCTTATGGGGATCATGTGCGTGCTGTCGGTCTGCTGGTCTCCGCTCCTGATAATGATGTTGAAAATGATCTTCAATCAGACATCAGTTGAGCACTGCAAGACACACACGGAGAAGCAGAAA

Ensembl | human accession no.

ENSG00000050628

NCBI accession no.

NM_198716

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTGER3(5733) , PTGER3(5733)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cristian Rodriguez-Aguayo et al.
EBioMedicine, 40, 290-304 (2019-01-19)
Inflammatory mediator prostaglandin E2-prostaglandin E2 receptor EP3 (PTGER3) signaling is critical for tumor-associated angiogenesis, tumor growth, and chemoresistance. However, the mechanism underlying these effects in ovarian cancer is not known. An association between higher tumoral expression of PTGER3 and shorter
Yao Ye et al.
Journal of cancer research and clinical oncology, 146(9), 2189-2203 (2020-06-04)
Cervical cancer metastasis results in poor prognosis and increased mortality, which is not separated from inflammatory reactions accumulated by prostaglandin E2 (PGE2). As a specific G-protein coupled PGE2 receptor, EP3 is demonstrated as a negative prognosticator of cervical malignancy. Now
Ju-Fang Liu et al.
Molecular cancer, 9, 43-43 (2010-02-25)
Cyclooxygenase (COX)-2, the inducible isoform of prostaglandin (PG) synthase, has been implicated in tumor metastasis. Interaction of COX-2 with its specific EP receptors on the surface of cancer cells has been reported to induce cancer invasion. However, the effects of
Chenggang Li et al.
Molecular cancer research : MCR, 15(10), 1318-1330 (2017-07-16)
Tuberous sclerosis complex (TSC) is a tumor-suppressor syndrome affecting multiple organs, including the brain, skin, kidneys, heart, and lungs. TSC is associated with mutations in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service