Skip to Content
Merck
All Photos(1)

Key Documents

EHU145411

Sigma-Aldrich

MISSION® esiRNA

targeting human MRGPRX2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGCCAACCCCATCATTTACTTCTTCGTGGGCTCTTTTAGGAAGCAGTGGCGGCTGCAGCAGCCGATCCTCAAGCTGGCTCTCCAGAGGGCTCTGCAGGACATTGCTGAGGTGGATCACAGTGAAGGATGCTTCCGTCAGGGCACCCCGGAGATGTCGAGAAGCAGTCTGGTGTAGAGATGGACAGCCTCTACTTCCATCAGATATATGTGGCTTTGAGAGGCAACTTTGCCCCTGTCTGTCTGATTTGCTGAACTTTCTCAGTCCTGATTTTAAAACAGTTAAGAGAGTCCTTGTGAGGATTAAGTGAGACAGTGCCTATGAAACAAACACTAAGTGCAGTGTCTCTGGAACTGCCTTACTCACAGGCTTCCACCACAGCCCTATGAGAGCTTTGCCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ibrahim Alkanfari et al.
Cells, 8(4) (2019-04-17)
Host-defense peptides (HDPs) have an important therapeutic potential against microbial infections but their metabolic instability and cellular cytotoxicity have limited their utility. To overcome these limitations, we utilized five small-molecule, nonpeptide HDP mimetics (smHDPMs) and tested their effects on cytotoxicity
Yingzhuan Zhan et al.
Chemico-biological interactions, 308, 304-311 (2019-05-28)
Polymyxin B (PMB) and polymyxin E (PME) are cyclic, peptide antibiotics which derived from various species of Paenibacillus (Bacillus) polymyxa. They are decapeptide antibiotics with an antimicrobial spectrum that includes Gram-negative bacteria, and reused as therapeutic agents due to the
Yuanyuan Lin et al.
Journal of separation science, 41(11), 2488-2497 (2018-03-02)
Adverse drug reactions of Danshen injection mainly manifested as pseudoallergic reactions. In the present study, salvianolic acid A and a pair of geometric isomers (isosalvianolic acid C and salvianolic acid C) were identified as pseudoallergic components in Danshen injection by

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service