Skip to Content
Merck
All Photos(1)

Key Documents

EMU011661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Icam1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTACATACGTGTGCCATGCCTTTAGCTCCCATGGGAATGTCACCAGGAATGTGTACCTGACAGTACTGTACCACTCTCAAAATAACTGGACTATAATCATTCTGGTGCCAGTACTGCTGGTCATTGTGGGCCTCGTGATGGCAGCCTCTTATGTTTATAACCGCCAGAGAAAGATCAGGATATACAAGTTACAGAAGGCTCAGGAGGAGGCCATAAAACTCAAGGGACAAGCCCCACCTCCCTGAGCCTGCTGGATGAGACTCCTGCCTGGACCCCCTGCAGGGCAACAGCTGCTGCTGCTTTTGAACAGAATGGTAGACAGCATTTACCCTCAGCCACTTCCTCTGGCTGTCACAGAACAGGATGGTGGCCTGGGGGATGCACACTTGTAGCCTCAGAGCTAAGAGGACTCGGTGGATGG

Ensembl | mouse accession no.

ENSMUSG00000037405

NCBI accession no.

NM_010493

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... ICAM1(15894) , Icam1(15894)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Weibao Xiao et al.
Experimental eye research, 138, 145-152 (2015-07-19)
FTY720 is a promising drug in attenuating multiple sclerosis, prolonging survival of organ allograft, and many other protective effects. Its mechanism of action is considered to be mediated by the internalization of sphingosine 1-phosphate receptors (S1PRs). In the current study
Chunhua Jin et al.
Molecular medicine (Cambridge, Mass.), 20, 280-289 (2014-06-12)
The myocardial inflammatory response contributes to cardiac functional injury associated with heart surgery obligating global ischemia/reperfusion (I/R). Toll-like receptors (TLRs) play an important role in the mechanism underlying myocardial I/R injury. The aim of this study was to examine the
Fumitake Ito et al.
The Journal of clinical endocrinology and metabolism, 99(6), 2188-2197 (2014-03-13)
Monocyte adhesion to endothelial cells is an important initial event in atherosclerosis and is partially mediated by adhesion molecule expression on the cell surface. Although estrogens inhibit atherosclerosis development, effects of coadministered progestogen remain controversial. We examined the effects of
Shiro Koizume et al.
Molecular cancer, 14, 77-77 (2015-04-17)
Elucidation of the molecular mechanisms by which cancer cells overcome hypoxia is potentially important for targeted therapy. Complexation of hypoxia-inducible factors (HIFs) with aryl hydrocarbon receptor nuclear translocators can enhance gene expression and initiate cellular responses to hypoxia. However, multiple
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 309(1), E35-E44 (2015-05-07)
Obesity is associated with inflammation and immune cell recruitment to adipose tissue, muscle and intima of atherosclerotic blood vessels. Obesity and hyperlipidemia are also associated with tissue insulin resistance and can compromise insulin delivery to muscle. The muscle/fat microvascular endothelium
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service