Skip to Content
Merck
All Photos(1)

Key Documents

EMU000241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Orai3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTCCACCAGTCACCACACCAACGACTGCACAGATACGTGGAGCTTGCCTGGGGCTTCTCTACTGCCTTGGGTACCTTTCTCTTCCTGGCTGAAGTTGTTCTGGTGGGCTGGGTCAAGTTTGTGCCCATTGGGGCACCCATGGGTAAACCAGCTCCTGTTGTACCTATGTCCCAGGTGCCACCTGTGACTGTCTCCCTTAGTTTAGCTTCTAACCTCACACCATCCTCTGCTTCTATTACCACATCACAACAGCCTTCCAAAGCCTGTCCACCCCGGCAAGTGTGTGATAGTGCTCATGGACCAGGCTGGCAGGCAGCTATGGCCTCCACGGCAATCATGGTACCTGTGGGACTAGTGTTTATGGCCTTTGCCCTACATTTCTACCGATCCTTGGTTGC

Ensembl | mouse accession no.

ENSMUSG00000043964

NCBI accession no.

NM_198424

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... ORAI3(269999) , Orai3(269999)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Michael A Thompson et al.
American journal of respiratory cell and molecular biology, 51(1), 68-76 (2014-01-30)
Plasma membrane Ca(2+) influx, especially store-operated Ca(2+) entry triggered by sarcoplasmic reticulum (SR) Ca(2+) release, is a key component of intracellular calcium concentration ([Ca(2+)]i) regulation in airway smooth muscle (ASM). Agonist-induced Ca(2+) oscillations in ASM that involve both influx and
Carlos Cantonero et al.
International journal of molecular sciences, 21(9) (2020-05-13)
Arachidonic acid (AA) is a phospholipase A2 metabolite that has been reported to mediate a plethora of cellular mechanisms involved in healthy and pathological states such as platelet aggregation, lymphocyte activation, and tissue inflammation. AA has been described to activate
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service