Skip to Content
Merck
All Photos(1)

Key Documents

EHU138031

Sigma-Aldrich

MISSION® esiRNA

targeting human ICAM1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGAACCTATCCCGGGACAGGGCCTCTTCCTCGGCCTTCCCATATTGGTGGCAGTGGTGCCACACTGAACAGAGTGGAAGACATATGCCATGCAGCTACACCTACCGGCCCTGGGACGCCGGAGGACAGGGCATTGTCCTCAGTCAGATACAACAGCATTTGGGGCCATGGTACCTGCACACCTAAAACACTAGGCCACGCATCTGATCTGTAGTCACATGACTAAGCCAAGAGGAAGGAGCAAGACTCAAGACATGATTGATGGATGTTAAAGTCTAGCCTGATGAGAGGGGAAGTGGTGGGGGAGACATAGCCCCACCATGAG

Ensembl | human accession no.

ENSG00000090339

NCBI accession no.

NM_000201

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ICAM1(3383) , ICAM1(3383)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Haifeng Ma et al.
Journal of cardiovascular pharmacology, 76(5), 617-626 (2020-11-10)
Emerging evidence has demonstrated that long noncoding RNAs are related to the pathogenesis of atherosclerosis. We aimed to investigate the roles and molecular mechanisms of myocardial infarction-associated transcript (MIAT) in the proliferation, migration, and invasion of oxidized low-density lipoprotein (ox-LDL)-induced
Sheng-Wei Lai et al.
Nutrients, 11(6) (2019-06-19)
Natural products have historically been regarded as an important resource of therapeutic agents. Resveratrol and melatonin have been shown to increase SIRT1 activity and stimulate deacetylation. Glioblastoma multiforme (GBM) is the deadliest of malignant types of tumor in the central
Dejun Xu et al.
Biological chemistry, 401(5), 601-615 (2019-12-22)
Long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been identified as a regulatory molecule in angiogenesis. The goal of this study was to illustrate how MEG3 affects the angiogenesis of vascular endothelial cells. Expression of MEG3, miR-147 and
Wei Gu et al.
Oncotarget, 8(67), 111882-111901 (2018-01-18)
Intercellular adhesion molecule-1 is the adhesion molecule mediating leukocyte firm adhesion to endothelial cells, plays a critical role in subsequent leukocyte transmigration. ICAM-1 is also expressed in other cells including macrophages; however, the role of this adhesion molecule in mediating
Hannah L Wiesolek et al.
The American journal of pathology, 190(4), 874-885 (2020-02-09)
Intercellular adhesion molecule-1 (ICAM-1) is up-regulated during inflammation by several cell types. ICAM-1 is best known for its role in mediating leukocyte adhesion to endothelial cells and guiding leukocytes across the vascular wall. Recently, macrophages have been shown to express
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service