Skip to Content
Merck
All Photos(1)

Key Documents

EHU143271

Sigma-Aldrich

MISSION® esiRNA

targeting human ILK

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhen-Hua Liu et al.
Nutrition and cancer, 72(6), 968-975 (2019-10-02)
The change of fatty acid composition has been regarded as an indicator of altered lipid metabolism during human tumourigenesis, but the details are still unclear. We have previously demonstrated a monounsaturated fatty acid (MUFA) named oleic acid (OA) was involved
Maria Louca et al.
Molecular and cellular biochemistry, 471(1-2), 143-153 (2020-06-09)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor and it is associated with poor survival. Integrin-linked kinase (ILK) is a serine/threonine protein pseudo-kinase that binds to the cytoplasmic domains of β1 and β3 integrins and has been
Patricia Sosa et al.
Aging and disease, 9(5), 769-784 (2018-10-03)
In mammalians, advancing age is associated with sarcopenia, the progressive and involuntary loss of muscle mass and strength. Hyperphosphatemia is an aging-related condition involved in several pathologies. The aim of this work was to assess whether hyperphosphatemia plays a role
Qiaomei Zheng et al.
Reproductive sciences (Thousand Oaks, Calif.), 23(11), 1526-1535 (2016-05-01)
To determine whether emodin facilitates the mesenchymal-epithelial transition (MET) of endometrial stromal cells (ESCs) as well as to explore the mechanism through which emodin favored the MET of ESCs. Cell viability was tested by methyl thiazolyl tetrazolium assay. Cell migration
Qiaomei Zheng et al.
Drug design, development and therapy, 14, 3663-3672 (2020-09-29)
To explore the exact mechanism through which emodin down-regulates the migration and invasion abilities of endometrial stromal cells. Moreover, to explore the theoretical basis of emodin in the treatment of endometriosis. Endometriosis endometrial stromal cells (EESs) were cultured from 15

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service