Skip to Content
Merck
All Photos(1)

Key Documents

EHU035311

Sigma-Aldrich

MISSION® esiRNA

targeting human DKK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCAGACTGTGCCTCAGGATTGTGTTGTGCTAGACACTTCTGGTCCAAGATCTGTAAACCTGTCCTGAAAGAAGGTCAAGTGTGTACCAAGCATAGGAGAAAAGGCTCTCATGGACTAGAAATATTCCAGCGTTGTTACTGTGGAGAAGGTCTGTCTTGCCGGATACAGAAAGATCACCATCAAGCCAGTAATTCTTCTAGGCTTCACACTTGTCAGAGACACTAAACCAGCTATCCAAATGCAGTGAACTCCTTTTATATAATAGATGCTATGAAAACCTTTTATGACCTTCATCAACTCAATCCTAAGGATATACAAGTTCTGTGGTTTCAGTTAAGCATTCCAATAACACCTTCCAAAAACCTGGAGTGTAAGAGCTTTGTTTCTTTATGGAACTCCCCTGTGATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ruirui Cheng et al.
Oncology reports, 37(4), 2129-2136 (2017-03-30)
The number of new lung cancer cases diagnosed yearly is high, and the mortality rate has not substantially declined. Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, and adenocarcinoma accounts for the largest proportion of
Shusuke Ueda et al.
Medical molecular morphology, 48(2), 69-75 (2014-05-14)
Osteonecrosis is a major glucocorticoid-induced complication in the orthopedics field. Despite the extensive researches, mechanisms underlining the glucocorticoid-induced osteonecrosis are largely unknown. Here, we first provide the evidence that a combined treatment of cultured osteocytic cells with glucocorticoid and hypoxia
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
A J Browne et al.
Cell death & disease, 7, e2119-e2119 (2016-02-26)
The Wnt inhibitor Dickkopf-1 (DKK-1) has been associated with the occurrence of bone metastases in osteotropic prostate cancer by inhibiting osteoblastogenesis. P38 mitogen-activated protein kinase (MAPK) activity is also dysregulated in advanced prostate cancer. However, the impact of p38 MAPK

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service