Skip to Content
Merck
All Photos(1)

Key Documents

EHU130951

Sigma-Aldrich

MISSION® esiRNA

targeting human OVOL1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCCAGTGGAGACCTGTTCACCTGCCGTGTCTGCCAGAAGGCCTTCACCTACCAGCGCATGCTGAACCGCCACATGAAGTGTCACAACGACGTCAAGAGGCACCTCTGCACGTACTGCGGGAAGGGCTTCAATGACACCTTCGACCTCAAGAGACACGTCCGAACTCACACTGGCGTGCGGCCCTACAAGTGCAGCCTGTGTGACAAGGCCTTCACGCAGCGCTGCTCTCTGGAGTCTCACCTCAAGAAGATCCATGGTGTGCAGCAGAAGTACGCGTACAAGGAGCGGCGGGCCAAGCTGTACGTGTGTGAGGAGTGCGGCTGCACATCTGAGAGCCAGGAGGGCCACGTCCTGCACCTGAAGGAGCACCACCCTGACAGCCCGCTGCTGCGCAAGACCTCCAAGAAGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Maho Murata et al.
Journal of clinical medicine, 9(3) (2020-02-29)
Progression of actinic keratosis (AK) to cutaneous squamous cell carcinoma (cSCC) is rare. Most cases of AK remain as intraepidermal lesions, owing to the suppression of the epithelial-to-mesenchymal transition (EMT). Ovo-like transcriptional repressor 1 (OVOL1) and ovo-like zinc finger 2
Akiko Hashimoto-Hachiya et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Rhodiola species are antioxidative, salubrious plants that are known to inhibit oxidative stress induced by ultraviolet and γ-radiation in epidermal keratinocytes. As certain phytochemicals activate aryl hydrocarbon receptors (AHR) or OVO-like 1 (OVOL1) to upregulate the expression of epidermal barrier
Stephen J Renaud et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(45), E6175-E6184 (2015-10-28)
Epithelial barrier integrity is dependent on progenitor cells that either divide to replenish themselves or differentiate into a specialized epithelium. This paradigm exists in human placenta, where cytotrophoblast cells either propagate or undergo a unique differentiation program: fusion into an

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service