Skip to Content
Merck
All Photos(1)

Key Documents

EHU011171

Sigma-Aldrich

MISSION® esiRNA

targeting human CSNK2A2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTATGACCAGCTTGTTCGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jintaek Im et al.
Apoptosis : an international journal on programmed cell death, 24(5-6), 499-510 (2019-03-10)
Idiopathic pulmonary fibrosis (IPF) is a deadly and progressive fibrotic lung disease, but the precise etiology remains elusive. IPF is characterized by the presence of apoptosis-resistant (myo)fibroblasts that relentlessly produce a collagen-rich extracellular matrix (ECM). Recent studies showed that an
Hai Lu et al.
Neoplasia (New York, N.Y.), 16(10), 789-800 (2014-11-08)
Cancer stem cells (CSC) and genes have been linked to cancer development and therapeutic resistance, but the signaling mechanisms regulating CSC genes and phenotype are incompletely understood. CK2 has emerged as a key signal serine/threonine kinase that modulates diverse signal
Sung Won Lee et al.
PloS one, 11(11), e0166450-e0166450 (2016-11-17)
Although alpha (α)B-crystallin is expressed in articular chondrocytes, little is known about its role in these cells. Protein kinase casein kinase 2 (CK2) inhibition induces articular chondrocyte death. The present study examines whether αB-crystallin exerts anti-apoptotic activity in articular chondrocytes.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service