Skip to Content
Merck
All Photos(1)

Key Documents

EMU201981

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akr1b3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCGTGAAAGTTGCTATTGACTTGGGGTACCGCCACATTGACTGCGCCCAGGTGTACCAGAATGAGAAGGAGGTGGGAGTGGCCCTCCAGGAGAAGCTCAAGGAGCAGGTGGTGAAGCGGCAGGATCTCTTCATTGTCAGCAAGCTGTGGTGCACGTTCCATGACAAGAGCATGGTGAAAGGAGCCTTCCAGAAGACACTGAGCGACCTGCAGCTGGACTACCTGGATCTCTACCTTATTCACTGGCCAACGGGGTTCAAGCCTGGGCCCGACTATTTCCCACTGGATGCCTCAGGGAACGTGATACCTAGTGACACCGATTTTGTGGACACTTGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
A Håkan Berg et al.
Endocrinology, 155(11), 4237-4249 (2014-07-12)
Rapid, cell surface-initiated, pregenomic androgen actions have been described in various vertebrate cells, but the receptors mediating these actions remain unidentified. We report here the cloning and expression of a cDNA from Atlantic croaker (Micropogonias undulatus) ovaries encoding a 33-kDa

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service