Skip to Content
Merck
All Photos(1)

Key Documents

EHU114181

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTTCACCTTTGTGTGTCCTACAGAAATTGTTGCTTTTAGTGACAAAGCTAACGAATTTCACGACGTGAACTGTGAAGTTGTCGCAGTCTCAGTGGATTCCCACTTTAGCCATCTTGCCTGGATAAATACACCAAGAAAGAATGGTGGTTTGGGCCACATGAACATCGCACTCTTGTCAGACTTAACTAAGCAGATTTCCCGAGACTACGGTGTGCTGTTAGAAGGTTCTGGTCTTGCACTAAGAGGTCTCTTCATAATTGACCCCAATGGAGTCATCAAGCATTTGAGCGTCAACGATCTCCCAGTGGGCCGAAGCGTGGAAGAAACCCTCCGCTTGGTGAAGGCGTTCCAGTATGTAGAAACACATGGAGAAGTCTGCCCAGCGAACTGGACACCGGATTCTCCTA

Ensembl | human accession no.

ENSG00000165672

NCBI accession no.

NM_006793

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRDX3(10935) , PRDX3(10935)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Min-Yao Jiang et al.
Oncotarget, 8(46), 80295-80302 (2017-11-09)
Benign prostatic hyperplasia (BPH) is one of the most common diseases in the senior men and age plays an important role in the initiation and development of BPH. Mammalian cells primarily use the autophagy-lysosome system to degrade misfolded/aggregated proteins and
Hua Zhang et al.
Oncotarget, 8(2), 3471-3480 (2016-12-15)
Peroxiredoxin (PRDX) proteins are involved in carcinogenesis. PRDX3, which is predominantly localized in mitochondria and up-regulated in several human cancers, seems to confer increased treatment resistance and aggressive phenotypes. This study examined the expression profile of PRDX3 and its possible
Inah Hwang et al.
Free radical biology & medicine, 131, 162-172 (2018-12-12)
Chronic kidney disease (CKD) has become epidemic worldwide. Mitochondrial reactive oxygen species (ROS)-induced oxidative stress is an important mediator of CKD, and Prx3 plays a critical role in maintenance of mitochondrial ROS. The present study examined the role of Prx3
Brian Cunniff et al.
PloS one, 10(5), e0127310-e0127310 (2015-05-27)
Dysregulation of signaling pathways and energy metabolism in cancer cells enhances production of mitochondrial hydrogen peroxide that supports tumorigenesis through multiple mechanisms. To counteract the adverse effects of mitochondrial peroxide many solid tumor types up-regulate the mitochondrial thioredoxin reductase 2--thioredoxin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service