Skip to Content
Merck
All Photos(1)

Key Documents

EHU035131

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF5

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACACATCAAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATTTTCATCAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTACCAGCTACTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTTAATGTTTCTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTGAAACAATTCCAGGGCAT

Ensembl | human accession no.

ENSG00000102554

NCBI accession no.

NM_001730

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KLF5(688) , KLF5(688)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qiu-Yu Wang et al.
Molecular oncology, 14(9), 2203-2230 (2020-05-28)
Long noncoding RNAs (lncRNAs) have important regulatory roles in cancer biology. Although some lncRNAs have well-characterized functions, the vast majority of this class of molecules remains functionally uncharacterized. To systematically pinpoint functional lncRNAs, a computational approach was proposed for identification
P Chen et al.
European review for medical and pharmacological sciences, 24(8), 4224-4231 (2020-05-07)
This study aims to investigate the expression characteristics of Krüppel-like factor 5 (KLF5) in gastric cancer (GC) and its potential correlation to pathological indexes in GC patients. Molecular mechanisms underlying the regulatory effect of KLF5 on GC progression are explored.
Kaixin Wangzhou et al.
Frontiers in physiology, 11, 606967-606967 (2021-02-20)
Human periodontal ligament cells (hPDLCs) play a vital role in cell regeneration and tissue repair with multi-directional differentiation potential. microRNAs (miRs) are implicated in the osteogenesis of hPDLCs. This study explored the mechanism of miR-143-3p in osteogenesis of hPDLCs. Osteogenic
Yan-Yi Jiang et al.
Gastroenterology, 159(4), 1311-1327 (2020-07-04)
We investigated the transcriptome of esophageal squamous cell carcinoma (ESCC) cells, activity of gene regulatory (enhancer and promoter regions), and the effects of blocking epigenetic regulatory proteins. We performed chromatin immunoprecipitation sequencing with antibodies against H3K4me1, H3K4me3, and H3K27ac and
Yubo Liu et al.
Nature communications, 11(1), 5898-5898 (2020-11-21)
O-GlcNAc modification plays critical roles in regulating the stress response program and cellular homeostasis. However, systematic and multi-omics studies on the O-GlcNAc regulated mechanism have been limited. Here, comprehensive data are obtained by a chemical reporter-based method to survey O-GlcNAc
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service