Skip to Content
Merck
All Photos(1)

Key Documents

EHU032751

Sigma-Aldrich

MISSION® esiRNA

targeting human THBS1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGAATTGGTGATGCCTGTGATGATGACGATGACAATGATAAAATTCCAGATGACAGGGACAACTGTCCATTCCATTACAACCCAGCTCAGTATGACTATGACAGAGATGATGTGGGAGACCGCTGTGACAACTGTCCCTACAACCACAACCCAGATCAGGCAGACACAGACAACAATGGGGAAGGAGACGCCTGTGCTGCAGACATTGATGGAGACGGTATCCTCAATGAACGGGACAACTGCCAGTACGTCTACAATGTGGACCAGAGAGACACTGATATGGATGGGGTTGGAGATCAGTGTGACAATTGCCCCTTGGAACACAATCCGGATCAGCTGGACTCTGACTCAGACCGCATTGGAGATACCTGTGACAACAATCAGGATATTGATGAAGATGGCCACCAGAAC

Ensembl | human accession no.

ENSG00000137801

NCBI accession no.

NM_003246

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... THBS1(7057) , THBS1(7057)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hui Hu et al.
Clinical science (London, England : 1979), 133(14), 1629-1644 (2019-07-19)
Background: Our previous studies observed that administration of exosomes from endothelial progenitor cells (EPC) facilitated vascular repair in the rat model of balloon injury. However, the molecular events underlying this process remain elusive. Here, we aim to interrogate the key
Shingo Semba et al.
Journal of biomedical materials research. Part A, 109(3), 354-364 (2020-06-05)
We previously demonstrated that a synthetic negatively charged poly(2-acrylamido-2-methylpropanesulfonic acid) (PAMPS) gel induced chondrogenic differentiation of ATDC5 cells. In this study, we clarified the underlying molecular mechanism, in particular, focusing on the events that occurred at the interface between the
Ho-Jun Shih et al.
American journal of cancer research, 10(6), 1728-1744 (2020-07-10)
Insulin-like growth factor binding protein-3 (IGFBP3) has been postulated to be a mediator of growth suppression signaling. It was shown to function as a suppressor of invasion in epithelial ovarian cancer (EOC). In this study, we identified an angiogenesis inhibitor
Jeneen Panezai et al.
Immunology, 152(2), 308-327 (2017-06-06)
Cell adhesion is generally considered to depend on positive regulation through ligation of integrins and cytokine receptors. However, here we show that T-cell adhesion, and notably also T-cell receptor (TCR) -induced activation, are subject to constant suppression through shedding of
Gun-Hoo Park et al.
Nature neuroscience, 23(11), 1352-1364 (2020-10-25)
The mechanisms by which prenatal immune activation increase the risk for neuropsychiatric disorders are unclear. Here, we generated developmental cortical interneurons (cINs)-which are known to be affected in schizophrenia (SCZ) when matured-from induced pluripotent stem cells (iPSCs) derived from healthy
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service