Skip to Content
Merck
All Photos(1)

Key Documents

EHU014641

Sigma-Aldrich

MISSION® esiRNA

targeting human ANKRD1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTCTAGCCCACCCTGTGACCCTGGGGGAGCAACAGTGGAAAAGCGAGAAACAACGAGAGGCAGAGCTCAAAAAGAAAAAACTAGAACAAAGATCAAAGCTTGAAAATTTAGAAGACCTTGAAATAATCATTCAACTGAAGAAAAGGAAAAAATACAGGAAAACTAAAGTTCCAGTTGTAAAGGAACCAGAACCTGAAATCATTACGGAACCTGTGGATGTGCCTACGTTTCTGAAGGCTGCTCTGGAGAATAAACTGCCAGTAGTAGAAAAATTCTTGTCAGACAAGAACAATCCAGATGTTTGTGATGAGTATAAACGGACAGCTCTTCATAGAGCATGCTTGGAAGGACATTTGGCAATTGTGGAGAAGTTAATGGAAGCTGGAGCCCAGATCGAATTCCGTGATATGCTTGAATCCACAGCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Adriana P Jiménez et al.
Oncotarget, 8(51), 88437-88452 (2017-11-29)
The Hippo pathway regulates organ size, growth and comprises several tumor related factors, including the oncoprotein YAP1 and the tumor suppressor RASSF1A.
Akiko Takahashi et al.
Scientific reports, 8(1), 14896-14896 (2018-10-07)
Overcoming acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) is critical in combating EGFR-mutant non-small cell lung cancer (NSCLC). We tried to construct a novel therapeutic strategy to conquer the resistance to second-and third-generation EGFR-TKIs in EGFR-positive
Fang Lu et al.
PloS one, 9(5), e97743-e97743 (2014-05-30)
The caspase-associated recruitment domain-containing protein (CARP) is expressed in almost all tissues. Recently, the tumor-suppressive function of CARP was discovered and attracted increasing attention. This study aimed to investigate the role of CARP in the carcinogenesis of human gastric carcinoma.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service