Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU009821

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAGCCACAGTGACAGGCAACCTGCTGGTACTCATCTCTTTCAAGGTCAACACGGAGCTCAAGACAGTCAATAACTACTTCCTGCTGAGCCTGGCCTGTGCTGACCTCATCATCGGTACCTTCTCCATGAACCTCTATACCACGTACCTGCTCATGGGCCACTGGGCTCTGGGCACGCTGGCTTGTGACCTCTGGCTGGCCCTGGACTATGTGGCCAGCAATGCCTCCGTCATGAATCTGCTGCTCATCAGCTTTGACCGCTACTTCTCCGTGACTCGGCCCCTGAGCTACCGTGCCAAGCGCACACCCCGCCGGGCAGCTCTGATGATCGGCCTGGCCTGGCTGGTTTCCTTTGTGCTCTGGGCCCCAGCCATCCTCTTCTGGCAGTACCTGGTAGGGGAGCGGACAGTGCTAGCTGGGCAGTGCTACATCCAGTTCCTCTCCCAGCCCATCATCACCTTTGGCACAGCCATGGCTGCCTTCTACCTCCCTGTCACAGTCATGTGCACGCTCTACTGGCGCATCTACC

Ensembl | human accession no.

ENSG00000168539

NCBI accession no.

NM_000738

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHRM1(1128) , CHRM1(1128)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xinping Yang et al.
American journal of translational research, 10(2), 629-638 (2018-03-08)
The FoxM1 (Forkhead Box M1) transcription factor plays a key role in regulation of cell growth, cell cycle, and transformation. Higher expression of FoxM1 has been observed in various types of human cancers including bladder cancer. However, the exact function
Deyu Zeng et al.
Journal of cellular biochemistry, 119(2), 1855-1865 (2017-08-13)
Pancreatic cancer is one of the major human malignant tumors severely endangering human health and life with high mortality due to the concealment of early symptoms and lack of effective therapies during advanced stages. The identification of pancreatic cancer stem
Tao Wang et al.
Molecular and cellular biochemistry, 413(1-2), 179-187 (2016-01-29)
The prolyl isomerase Pin1, which is frequently highly expressed in many different cancers, can directly regulate cell proliferation and the cell cycle. However, the role of Pin1 in chemo-resistance remains to be elucidated in cervical cancer. The purpose of the
Rui-Tao Wang et al.
World journal of gastroenterology, 27(8), 692-707 (2021-03-16)
Gallbladder cancer (GBC) is an aggressive type of biliary tract cancer that lacks effective therapeutic targets. Fork head box M1 (FoxM1) is an emerging molecular target associated with tumor progression in GBC, and accumulating evidence suggests that vascular endothelial growth
Jingjing Zhang et al.
Gynecologic and obstetric investigation, 84(5), 485-494 (2019-05-01)
The aim of this study was to investigate the expression of Forkhead box M1 (FoxM1) in endometriosis and determine FoxM1's possible effects on endometriotic epithelial cells (EECs) invasion and epithelial-mesenchymal transition (EMT). The expression of FoxM1 and E-cadherin in endometrium
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service