Skip to Content
Merck
All Photos(1)

Key Documents

EHU002791

Sigma-Aldrich

MISSION® esiRNA

targeting human SERPINB2, SERPINB10

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAGAACCCCAGGCAGTAGACTTCCTAGAATGTGCAGAAGAAGCTAGAAAAAAGATTAATTCCTGGGTCAAGACTCAAACCAAAGGCAAAATCCCAAACTTGTTACCTGAAGGTTCTGTAGATGGGGATACCAGGATGGTCCTGGTGAATGCTGTCTACTTCAAAGGAAAGTGGAAAACTCCATTTGAGAAGAAACTAAATGGGCTTTATCCTTTCCGTGTAAACTCGGCTCAGCGCACACCTGTACAGATGATGTACTTGCGTGAAAAGCTAAACATTGGATACATAGAAGACCTAAAGGCTCAGATTCTAGAACTCCCATATGCTGGAGATGTTAGCATGTTCTTGTTGCTTCCAGATGAAATTGCCGATGTGTCCACTGGCTTGGAGCTGCTGGAAAGTGAAATAACCTATGACAAACTCAACAAGTGGACCAGCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ziqi Meng et al.
International immunopharmacology, 81, 106028-106028 (2019-12-06)
To investigate the effect of miR-200c/PAI-2 on macrophage polarization into M2-type TAMs in TNBC. PAI-2 expression in MDA-MB-231con, MDA-MB-231miR-200ab and MDA-MB-231miR-200c breast cancer cells was evaluated by RT-PCR and immunofluorescence (IF), while the expression of the TAM marker F4/80 and
Tiefeng Jin et al.
Oncotarget, 8(20), 32769-32782 (2017-04-22)
The microRNA-200 (miR-200) family is associated with tumor metastasis and poor patient prognosis. We found that miR-200c/141 cluster overexpression upregulated SerpinB2 in the MDA-MB-231 triple-negative (TN) breast cancer cell line. We observed transcription factor (c-Jun, c-Fos, and FosB) upregulation, nuclear
Eleonora Longhin et al.
Archives of toxicology (2018-07-11)
Exposure to particulate matter (PM) has been related to the onset of adverse health effects including lung cancer, but the underlying molecular mechanisms are still under investigation. Epithelial-to-mesenchymal transition (EMT) is regarded as a crucial step in cancer progression. In
Na-Hee Lee et al.
Cell death & disease, 9(7), 724-724 (2018-06-22)
The toxicological evaluation of potential drug candidates is very important in the preclinical phase of drug development. Toxic materials may cause serious decline in stem cell function and loss of stemness. Indeed, we found that toxic exposure more profoundly suppressed
Lei Hu et al.
Cell death & disease, 11(3), 172-172 (2020-03-07)
Mesenchymal stem cell (MSCs) transplantation has been used to treat Sjögren's syndrome (SS) based on the immunoregulatory properties of MSCs. However, the effectiveness need improving and its underlying intrinsic mechanisms remain largely unknown. Here, we show that Id3 is upregulated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service