Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU130891

Sigma-Aldrich

MISSION® esiRNA

targeting human TUG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAAGATGCCAGTTTTTGCTTCTTTGTTAGTTGTCAGCTGCTTTTATCAAATTTCAGGCCATTATCCAACAAACACTATAAAAATGTTTGAACAATTGGATTTCAAACATTTTCGTTTTGTGGAGTGGTGCTCACCAAGTGGTACAGCCCTAAGCAAGTGAACACAAACACATTTAAGTGTATTTTGTCTGATTAGATGTTAGCCAGTTATGCTATTTCATTCAAATGTCTGAAAAAATCAATTGACTATTCCCTTTTCCTAAAGGGCAGAGACAGATAATCTCACTTCCAGAGAAATGACTTGGAGAAAAAAAAGTGTTGGTCTTTTTGCTCTTTTGTAATTAAATCCGGATGTACCTCAAAAGACTTAAGACTGTGGTGATAAGATGCTTTCCTCAGCAGAAAGGAGGGAAAAAAAACAACTGGAACTCAAAGCTTGAAATTCTGTGGCAAAACATGAGATGTCCAGGATTGGAGGTTGAA

Numéro d'accès Ensembl | humain

ENSG00000182457

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TUG1(55000)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

T Xu et al.
European review for medical and pharmacological sciences, 23(11), 4698-4705 (2019-06-19)
To explore the correlation between plasma level of lncRNA TUG1 with PSA level, Gleason grading and tumor node metastasis (TNM) stage of prostate cancer (PCa) patients. This study aims to evaluate the potential diagnostic and prognostic values of TUG1 in
Pan Wang et al.
Journal of experimental & clinical cancer research : CR, 39(1), 7-7 (2020-01-11)
Long noncoding RNAs (lncRNAs) are involved in the progression of various cancers and affect the response to radiotherapy. This study focused on clarifying the underlying mechanism by which lncTUG1 affects the radiosensitivity of esophageal squamous cell carcinoma (ESCC). lncTUG1, miR-144-3p
Dong Lv et al.
OncoTargets and therapy, 13, 5857-5868 (2020-07-02)
Clear cell renal cell carcinoma (ccRCC) is a common urological carcinoma in adults. Long non-coding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) has been reported to be involved in the progression of diverse human cancers, including renal cell carcinoma (RCC). However
Ganhua You et al.
Drug design, development and therapy, 14, 457-468 (2020-02-27)
Metformin has been shown to inhibit the proliferation and migration of vascular wall cells. However, the mechanism through which metformin acts on atherosclerosis (AS) via the long non-coding RNA taurine up-regulated gene 1 (lncRNA TUG1) is still unknown. Thus, this
Dianhui Xiu et al.
OncoTargets and therapy, 13, 2319-2331 (2020-04-08)
Prostate cancer (PCa) is a common malignant tumor of the urinary system in males. LncRNA taurine-upregulated gene 1 (TUG1) has been verified to play a crucial role in progression and prognosis of PCa. However, the functional mechanism of TUG1 remains
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique