Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU125271

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAUR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCAGCCCTGAAGAACAGTGCCTGGATG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

K D Rysenkova et al.
Cellular signalling, 75, 109741-109741 (2020-08-22)
Urokinase-type plasminogen activator uPA and its receptor (uPAR) are the central players in extracellular matrix proteolysis, which facilitates cancer invasion and metastasis. EGFR is one of the important components of uPAR interactome. uPAR/EGFR interaction controls signaling pathways that regulate cell
Xin Li et al.
Oncotarget, 8(51), 88645-88657 (2017-11-29)
Dissection and understanding of the molecular pathways driving triple-negative breast cancer (TNBC) are urgently needed to develop efficient tailored therapies. Aside from cell invasion and metastasis, the urokinase-type plasminogen activator receptor (uPAR) has been linked to apoptosis resistance in breast
Yohei Yamagami et al.
Biochemical and biophysical research communications, 525(3), 543-548 (2020-03-03)
There is increasing evidence that epithelial-mesenchymal transition (EMT) contributes to the development of organ fibrosis. We demonstrated that methotrexate (MTX) clearly induced EMT through the transforming growth factor (TGF)-β-related signaling pathway in human alveolar epithelial cell line, A549. However, critical
Xuexiang Gao et al.
Oncology letters, 16(3), 3983-3991 (2018-08-22)
Overexpression of urokinase-type plasminogen activator receptor (uPAR) has been implicated in promoting tumor invasion in various cancer types, including oral tongue squamous cell carcinoma (OTSCC); therefore, the effect of suppressing uPAR expression on the invasive and metastatic potential of OTSCC
Anna Laurenzana et al.
International journal of cancer, 141(6), 1190-1200 (2017-06-04)
In this manuscript, we show the involvement of the uPA/uPAR system in the regulation of aerobic glycolysis of melanoma cells. uPAR over-expression in human melanoma cells controls an invasive and glycolytic phenotype in normoxic conditions. uPAR down-regulation by siRNA or

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique