Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU124431

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCCCAGCAGTCTCTTACCTTCCCTGATCTTTGCAGGGTGGTCCGTGTAAATAGTATAAATTCTCCAAATTATCCTCTAATTATAAATGTAAGCTTATTTCCTTAGATCATTATCCAGAGACTGCCAGAAGGTGGGTAGGATGACCTGGGGTTTCAATTGACTTCTGTTCCTTGCTTTTAGTTTTGATAGAAGGGAAGACCTGCAGTGCACGGTTTCTTCCAGGCTGAGGTACCTGGATCTTGGGTTCTTCACTGCAGGGACCCAGACAAGTGGATCTGCTTGCCAGAGTCCTTTTTGCCCCTCCCTGCCACCTCCCCGTGTTTCCAAGTCAGCTTTCCTGCAAGAAGAAATCCTGGTTAAAAAAGTCTTTTGTATTGGGTCAGGAGTTGAATTTGGGGTGGGAGGATGGATGCAACTGAAGC

Numéro d'accès Ensembl | humain

ENSG00000111206

Numéro d'accès NCBI

NM_021953

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FOXM1(2305) , FOXM1(2305)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qiyan Hu et al.
Oncology letters, 15(6), 10063-10069 (2018-06-22)
Cervical cancer is the second most common type of cancer in females worldwide. It has been demonstrated that microRNAs (miRs) serve important roles in the occurrence and development of various types of cancer, including cervical cancer. The results of the
Paweena Dana et al.
Cellular oncology (Dordrecht), 43(2), 211-222 (2019-11-16)
Cholangiocarcinoma (CCA) is an aggressive type of cancer. The major obstacles for treatment are its late presentation and the occurrence metastases. Targeting the metastatic process may serve as a treatment option. CD147 is a membrane protein that promotes CCA metastasis.
Xiaocheng Cao et al.
Journal of oncology, 2020, 8978930-8978930 (2020-04-21)
Whether DNA methyltransferase 1 (DNMT1)/miR-34a/FoxM1 signaling promotes the stemness of liver cancer stem cells (LCSCs) remains unclear. This study aimed to assess whether methylation-based silencing of miR-34a by DNMT1 contributes to stemness features via FoxM1 upregulation in LCSCs. The CD133+
Li-Fang Chou et al.
Biomolecules, 10(1) (2019-12-28)
Daphne genkwa, a Chinese medicinal herb, is used frequently in Southeast Asian countries to treat diseases; the flavonoid hydroxygenkwanin (HGK) is extracted from its flower buds. The bioactivity of HGK, particularly as an anti-liver cancer agent, has not been explored.
Thomas G Blanchard et al.
Cancers, 11(2) (2019-02-13)
Metastatic colorectal cancer (mCRC) is characterized by the expression of cellular oncogenes, the loss of tumor suppressor gene function. Therefore, identifying integrated signaling between onco-suppressor genes may facilitate the development of effective therapy for mCRC. To investigate these pathways we
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique