Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU093591

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAACTGGGAAGCTTGATGGACCAGACAAATAGGATGATGGCTGCCCCCACACAATAAATGGTAACATAGGAGACATCCACATCCCAATTCTGACAAGACCTCATGCCTGAAGACAGCTTGGGCAGGTGAAACCAGAATATGTGAACTGAGTGGACACCCGAGGCTGCCACTGGAATGTCTTCTCAGGCCATGAGCTGCAGTGACTGGTAGGGCTGTGTTTACAGTCAGGGCCACCCCGTCACATATACAAAGGAGCTGCCTGCCTGTTTGCTGTGTTGAACTCTTCACTCTGCTGAAGCTCCTAATGGAAAAAGCTTTCTTCTGACTGTGACCCTCTTGAACTGAATCAGACCAACTGGAATCCCAGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Application

MISSION® esiRNA has been used for transfection of cells to target SIRT3.

Actions biochimiques/physiologiques

SIRT3 (sirtuin 3) is a mitochondrial deacetylase, which acts as an oncogene. It is associated with the initiation and progression of certain cancers. However, in some cases it also works anti-oncogenically. It plays a major role in mitochondrial activity via deacetylating proteins associated with energy metabolism, ATP generation, redox optimization, and mitochondrial biogenesis. It is also involved in transcription, insulin secretion and apoptosis. Deacetylation of cyclophilin-D via SIRT3 inhibits age-associated cardiac hypertrophy. SIRT3 also exhibits neuroprotective roles.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

SIRT3 is correlated with the malignancy of non-small cell lung cancer.
Xiong Y, et. al.
International Journal of Oncology, 50, 903-903 (2017)
Mitochondrial SIRT3 mediates adaptive responses of neurons to exercise and metabolic and excitatory challenges.
Cheng A
Cell Metabolism, 23, 128-142 (2016)
Xiaokan Zhang et al.
Circulation, 137(19), 2052-2067 (2018-01-14)
Heart failure leads to mitochondrial dysfunction and metabolic abnormalities of the failing myocardium coupled with an energy-depleted state and cardiac remodeling. The mitochondrial deacetylase sirtuin 3 (SIRT3) plays a pivotal role in the maintenance of mitochondrial function through regulating the
Chao Song et al.
Free radical biology & medicine, 112, 616-630 (2017-09-16)
Mitochondrial reactive oxygen species (ROS) production has been implicated in the pathogenesis of fluoride toxicity in liver. Melatonin, an indolamine synthesized in the pineal gland, was previously shown to protect against sodium fluoride (NaF)-induced hepatotoxicity. This study investigated the protective
Marija Pinterić et al.
Antioxidants (Basel, Switzerland), 9(4) (2020-04-05)
Estrogen (E2) is a major risk factor for the initiation and progression of malignancy in estrogen receptor (ER) positive breast cancers, whereas sirtuin 3 (Sirt3), a major mitochondrial NAD+-dependent deacetylase, has the inhibitory effect on the tumorigenic properties of ER

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique