Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU012751

Sigma-Aldrich

MISSION® esiRNA

targeting human LEP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAGAAAGTCACCGGTTTGGACTTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCTACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTGGAGAACCTCCGGGATCTTCTTCACGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGGGGTGTCCTGGAAGCTTCAGGCTACTCCACAGAGGTGGTGGCCCTGAGCAGGCTGCAGGGGTCTCTGCAGGACATGCTGTGGCAGCTGGACCTCAGCCCTGGGTGCTGAGGCCTTGAAGGTCACTCTTCCTGCAAGGACTACGTTAAGGGAAGGAACTCTGGCTTCCAGGTATCTCCAGGATTGAAGAGCATTGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Beniamin Oskar Grabarek et al.
International journal of molecular sciences, 22(4) (2021-02-11)
Psoriasis is a disease with a proinflammatory base, in which an increased expression of leptin, tumor necrosis factor alpha (TNF-α), interleukin (IL) IL-12/23, IL-6, is observed. A drug used in the treatment of psoriasis of moderate and acute strength is
Dariusz Dąbruś et al.
International journal of molecular sciences, 21(11) (2020-06-14)
This research aimed to assess the impact of cisplatin, depending on the concentration and exposure time, on the expression pattern of leptin in an endometrial cancer cell line. Ishikawa endometrial cancer cell cultures were incubated with cisplatin, at concentrations of
Amy L Strong et al.
Breast cancer research : BCR, 17, 112-112 (2015-08-20)
The steady increase in the incidence of obesity among adults has been paralleled with higher levels of obesity-associated breast cancer. While recent studies have suggested that adipose stromal/stem cells (ASCs) isolated from obese women enhance tumorigenicity, the mechanism(s) by which

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique