Direkt zum Inhalt
Merck

EHU129811

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA6

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCAACTGTCACACCACAACTACCACCTTATGGCGCAGAAACGCCGAGGGTGAACCCGTGTGCAATGCTTGTGGACTCTACATGAAACTCCATGGGGTGCCCAGACCACTTGCTATGAAAAAAGAGGGAATTCAAACCAGGAAACGAAAACCTAAGAACATAAATAAATCAAAGACTTGCTCTGGTAATAGCAATAATTCCATTCCCATGACTCCAACTTCCACCTCTTCTAACTCAGATGATTGCAGCAAAAATACTTCCCCCACAACACAACCTACAGCCTCAGGGGCGGGTGCCCCGGTGATGACTGGTGCGGGAGAGAGCACCAATCCCGAGAACAGCGAGCTCAAGTATTCGGGTCAAGATGGGCTCTACATAGGCGTCAGTCTCGCCTCGCCGGCCGAAGTCACGTCCTCCGTGCGACCGGATTCCTGGTGCGCCCTGGCCCTGGCCTGAGCCCACGCCGCCAGGAGGCAGGGAGGGCTCCGCCGCGGGCCTCACTCCACTCGTGTCTGCTTTTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ruishuang Ma et al.
Cancer biology & therapy, 20(9), 1206-1212 (2019-05-17)
Autophagy plays a complicated role in tumorigenesis, and the effects of autophagy in drug resistance have not been fully known. The aim of this study was to evaluate autophagy activity in lung cancer cells derived from different origins and explore
Mao Guoping et al.
Oncology research, 26(7), 1023-1029 (2018-01-13)
Recent studies have suggested that the dysregulation of microRNAs (miRNAs) plays a critical role in the progression of human cancers, including gastric cancer (GC). miR-143 had been reported to function as a tumor suppressor in GC. However, the exact molecular
Chellappagounder Thangavel et al.
The American journal of pathology, 189(4), 847-867 (2019-02-02)
Caveolins (CAVs) are structural proteins of caveolae that function as signaling platforms to regulate smooth muscle contraction. Loss of CAV protein expression is associated with impaired contraction in obstruction-induced bladder smooth muscle (BSM) hypertrophy. In this study, microarray analysis of
Mio Nakanishi et al.
Cell, 177(4), 910-924 (2019-04-16)
The assembly of organized colonies is the earliest manifestation in the derivation or induction of pluripotency in vitro. However, the necessity and origin of this assemblance is unknown. Here, we identify human pluripotent founder cells (hPFCs) that initiate, as well as
Holly Brunton et al.
Cell reports, 31(6), 107625-107625 (2020-05-14)
Pancreatic ductal adenocarcinoma (PDAC) can be divided into transcriptomic subtypes with two broad lineages referred to as classical (pancreatic) and squamous. We find that these two subtypes are driven by distinct metabolic phenotypes. Loss of genes that drive endodermal lineage

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.