Direkt zum Inhalt
Merck

EHU129271

Sigma-Aldrich

MISSION® esiRNA

targeting human DDX5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hao Zhang et al.
Hepatology (Baltimore, Md.), 69(3), 1046-1063 (2018-10-04)
In hepatocellular carcinoma (HCC), dysregulated expression of DDX5 (DEAD box protein 5) and impaired autophagy have been reported separately. However, the relationship between them has not been explored. Here we present evidence to show that, by interacting with autophagic receptor
Nazia Abbasi et al.
Life science alliance, 3(10) (2020-08-21)
Tumorigenesis in different segments of the intestinal tract involves tissue-specific oncogenic drivers. In the colon, complement component 3 (C3) activation is a major contributor to inflammation and malignancies. By contrast, tumorigenesis in the small intestine involves fatty acid-binding protein 1
Saravana Kumar Kailasam Mani et al.
Theranostics, 10(24), 10957-10972 (2020-10-13)
Rationale: RNA helicase DDX5 is downregulated during hepatitis B virus (HBV) replication, and poor prognosis HBV-related hepatocellular carcinoma (HCC). The aim of this study is to determine the mechanism and significance of DDX5 downregulation for HBV-driven HCC, and identify biologics
Sofiane Y Mersaoui et al.
The EMBO journal, 38(15), e100986-e100986 (2019-07-04)
Aberrant transcription-associated RNA:DNA hybrid (R-loop) formation often causes catastrophic conflicts during replication, resulting in DNA double-strand breaks and genomic instability. Preventing such conflicts requires hybrid dissolution by helicases and/or RNase H. Little is known about how such helicases are regulated.
Yeon J Lee et al.
Genes & development, 32(15-16), 1060-1074 (2018-07-26)
Alternative premessenger RNA (pre-mRNA) splicing is a post-transcriptional mechanism for controlling gene expression. Splicing patterns are determined by both RNA-binding proteins and nuclear pre-mRNA structure. Here, we analyzed pre-mRNA splicing patterns, RNA-binding sites, and RNA structures near these binding sites

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.