Direkt zum Inhalt
Merck

EHU098571

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTTCCATCACATTGCAACAGATGTTGGGCCCTTCGTGAGAATTGGCTTCCTGAAGATAAAGGGAAAGATAAAGGGGAAATCTCTGAGAAAGCCAAACTGGAAAACTCAACACAAGCTGAAGAGGGCTTTGATGTTCCTGATTGTAAAAAAACTATAGTGAATGATTCCAGAGAGTCATGTGTTGAGGAAAATGATGATAAAATTACACAAGCTTCACAATCACAAGAAAGTGAAGACTATTCTCAGCCATCAACTTCTAGTAGCATTATTTATAGCAGCCAAGAAGATGTGAAAGAGTTTGAAAGGGAAGAAACCCAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Chengtao Sun et al.
OncoTargets and therapy, 13, 10475-10487 (2020-10-30)
Cell-division cycle 20 (CDC20) is overexpressed in a variety of tumor cells and is negatively regulated by wild-type p53 (wtp53). Our previous study uncovered that CDC20 was upregulated and associated with poor outcome in diffuse large B-cell lymphoma (DLBCL) based
Hao Zhao et al.
Inflammation, 40(1), 232-239 (2016-11-14)
Inflammation has been implicated in myocardial infarction (MI). MDM2 associates with nuclear factor-κB (NF-κB)-mediated inflammation. However, the role of MDM2 in MI remains unclear. This study aimed to evaluate the impacts of MDM2 inhibition on cardiac dysfunction and fibrosis after
Jingwen Xu et al.
Cancer letters, 383(1), 9-17 (2016-10-30)
2-Methoxy-5((3,4,5-trimethosyphenyl)seleninyl) phenol (SQ) is a novel synthesized combretastatin A-4 (CA-4) analog that can be classified as a microtubule inhibitor. Our previous study demonstrated that SQ induced G2/M phase arrest and promoted apoptosis progression in breast cancer cells. In the present
Lingxin Meng et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 107, 139-145 (2018-08-08)
Vascular endothelial growth factor (VEGF) signaling promotes angiogenesis by stimulating the migration and proliferation of endothelial cells. The aim of this study was to investigate the expression of Survivin and VEGF receptor 1/2/3 (VEGFR 1/2/3) in esophageal carcinoma tissues (ECTs)
Yong Tang et al.
OncoTargets and therapy, 12, 2247-2258 (2019-04-17)
Mouse double minute 2 (MDM2) contributes to cancer metastasis and epithelial-mesenchymal transition (EMT). This study aimed to investigate small mothers against decapentaplegic (Smad) signaling in MDM2-mediated EMT in lung adenocarcinoma (LAC). Expression patterns of MDM2 in LAC tissues, adjacent tissues

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.