Direkt zum Inhalt
Merck

EHU093591

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAAACTGGGAAGCTTGATGGACCAGACAAATAGGATGATGGCTGCCCCCACACAATAAATGGTAACATAGGAGACATCCACATCCCAATTCTGACAAGACCTCATGCCTGAAGACAGCTTGGGCAGGTGAAACCAGAATATGTGAACTGAGTGGACACCCGAGGCTGCCACTGGAATGTCTTCTCAGGCCATGAGCTGCAGTGACTGGTAGGGCTGTGTTTACAGTCAGGGCCACCCCGTCACATATACAAAGGAGCTGCCTGCCTGTTTGCTGTGTTGAACTCTTCACTCTGCTGAAGCTCCTAATGGAAAAAGCTTTCTTCTGACTGTGACCCTCTTGAACTGAATCAGACCAACTGGAATCCCAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Anwendung

MISSION® esiRNA has been used for transfection of cells to target SIRT3.

Biochem./physiol. Wirkung

SIRT3 (sirtuin 3) is a mitochondrial deacetylase, which acts as an oncogene. It is associated with the initiation and progression of certain cancers. However, in some cases it also works anti-oncogenically. It plays a major role in mitochondrial activity via deacetylating proteins associated with energy metabolism, ATP generation, redox optimization, and mitochondrial biogenesis. It is also involved in transcription, insulin secretion and apoptosis. Deacetylation of cyclophilin-D via SIRT3 inhibits age-associated cardiac hypertrophy. SIRT3 also exhibits neuroprotective roles.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lorissa J Smulan et al.
mBio, 12(1) (2021-02-04)
Mycobacterium tuberculosis induces metabolic reprogramming in macrophages like the Warburg effect. This enhances antimicrobial performance at the expense of increased inflammation, which may promote a pathogen-permissive host environment. Since the NAD+-dependent protein deacetylase Sirtuin 3 (SIRT3) is an important regulator
Marija Pinterić et al.
Antioxidants (Basel, Switzerland), 9(4) (2020-04-05)
Estrogen (E2) is a major risk factor for the initiation and progression of malignancy in estrogen receptor (ER) positive breast cancers, whereas sirtuin 3 (Sirt3), a major mitochondrial NAD+-dependent deacetylase, has the inhibitory effect on the tumorigenic properties of ER
Pro-Proliferative Function of Mitochondrial Sirtuin Deacetylase SIRT3 in Human Melanoma.
George J
The Journal of Investigative Dermatology, 136, 809-809 (2016)
SIRT3 is correlated with the malignancy of non-small cell lung cancer.
Xiong Y, et. al.
International Journal of Oncology, 50, 903-903 (2017)
Xiaokan Zhang et al.
Circulation, 137(19), 2052-2067 (2018-01-14)
Heart failure leads to mitochondrial dysfunction and metabolic abnormalities of the failing myocardium coupled with an energy-depleted state and cardiac remodeling. The mitochondrial deacetylase sirtuin 3 (SIRT3) plays a pivotal role in the maintenance of mitochondrial function through regulating the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.