Direkt zum Inhalt
Merck

EHU089961

Sigma-Aldrich

MISSION® esiRNA

targeting human LYN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGAGGGAATGGCATACATCGAGCGGAAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATGTGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGGGAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTCACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGGAAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTACAGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGGAAAGAAAAGGCAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shuaibin Liu et al.
Oncotarget, 7(46), 75468-75481 (2016-10-01)
Cervical cancer is one of the most common malignant tumor in women. The mechanisms of cervical cancer are intricate and have not been fully understood. Therefore, we employed iTRAQ to obtain novel proteins profile which participates in the tumor oncogenesis
Xiaoyun Wang et al.
Scientific reports, 7, 42675-42675 (2017-02-17)
Hypersecretion of mucus is an important component of airway remodeling and contributes to the mucus plugs and airflow obstruction associated with severe asthma phenotypes. Lyn has been shown to down-regulate allergen-induced airway inflammation. However, the role of Lyn in mucin
Lei Meng et al.
Acta biochimica et biophysica Sinica, 52(1), 49-57 (2019-12-13)
Gastric cancer (GC) is one of malignant tumors with high mortality and morbidity in the world. MicroRNA-122 (miR-122) acts as a tumor suppressor in a variety of cancers and has been found to be dominant in gastric adenocarcinoma. However, the
D Thaper et al.
Oncogene, 36(28), 3964-3975 (2017-03-14)
The acquisition of an invasive phenotype by epithelial cells occurs through a loss of cellular adhesion and polarity, heralding a multistep process that leads to metastatic dissemination. Since its characterization in 1995, epithelial-mesenchymal transition (EMT) has been closely linked to
Pradip Das et al.
Journal of immunology (Baltimore, Md. : 1950), 206(1), 181-192 (2020-12-06)
MCP-1-induced monocyte chemotaxis is a crucial event in inflammation and atherogenesis. Identifying the important signal transduction pathways that control monocyte chemotaxis can unravel potential targets for preventive therapies in inflammatory disease conditions. Previous studies have shown that the focal adhesion

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.