Direkt zum Inhalt
Merck

EHU070911

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAACGGGACAAATCCTAGAGGGTATAAAATCATCTCTGCTCAGATAATCATGACTTAGCAAGAATAAGGGCAAAAAATCCTGTTGGCTTAACGTCACTGTTCCACCCGGTGTAATATCTCTCATGACAGTGACACCAAGGGAAGTTGACTAAGTCACATGTAAATTAGGAGTGTTTTAAAGAATGCCATAGATGTTGATTCTTAACTGCTACAGATAACCTGTAATTGAGCAGATTTAAAATTCAGGCATACTTTTCCATTTATCCAAGTGCTTTCATTTTTCCAGATGGCTTCAGAAGTAGGCTCGTGGGCAGGGCGCAGACCTGATCTTTATAGGGTTGACATAGAAAGCAGTAGTTGTGGGTGAAAGGGCAGGTTGTCTTCAAACTCTGTGAGGTAGAATCCTTTGTCTATACCTCCATGAACATTGACTCGTGTGTTCAGAGCCTTTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Eduardo A Sagredo et al.
Biochimica et biophysica acta. Molecular cell research, 1867(8), 118716-118716 (2020-04-11)
RNA editing has emerged as a novel mechanism in cancer progression. The double stranded RNA-specific adenosine deaminase (ADAR) modifies the expression of an important proportion of genes involved in cell cycle control, DNA damage response (DDR) and transcriptional processing, suggesting
Mako Yanai et al.
Journal of virology, 94(6) (2019-12-20)
Cells sense pathogen-derived double-stranded RNA (dsRNA) as nonself. To avoid autoimmune activation by self dsRNA, cells utilize A-to-I editing by adenosine deaminase acting on RNA 1 (ADAR1) to disrupt dsRNA structures. Considering that viruses have evolved to exploit host machinery
Maria Pujantell et al.
Scientific reports, 9(1), 19848-19848 (2019-12-29)
Infection by human papillomavirus (HPV) alters the microenvironment of keratinocytes as a mechanism to evade the immune system. A-to-I editing by ADAR1 has been reported to regulate innate immunity in response to viral infections. Here, we evaluated the role of
Yan Sun et al.
Cell death & disease, 11(6), 432-432 (2020-06-10)
Vascular remodeling can be caused by angiotensin II type 1 receptor (AT1R) autoantibody (AT1-AA), although the related mechanism remains unknown. Angiotensin II type 2 receptor (AT2R) plays multiple roles in vascular remodeling through cross-talk with AT1R in the cytoplasm. Here
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.