Direkt zum Inhalt
Merck

EHU065431

Sigma-Aldrich

MISSION® esiRNA

targeting human KEAP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jing-Lei Yang et al.
Aging, 12(11), 10370-10380 (2020-06-03)
In cultured human umbilical vein endothelial cells (HUVECs) high glucose (HG) stimulation will lead to significant cell death. Bardoxolone-methyl (BARD) is a NF-E2 p45-related factor 2 (Nrf2) agonist. In this study we show that BARD, at only nM concentrations, activated
Min-Kyun Song et al.
Free radical biology & medicine, 138, 33-42 (2019-05-07)
Transforming growth factor-β (TGF-β) is a potent pathogenic factor of renal injury through the upregulation of extracellular matrix (ECM) expression and facilitation of renal fibrosis. Nuclear factor erythroid 2-like 2 (Nfe2l2; Nrf2), a master regulator of antioxidant and detoxifying systems
Min Cai et al.
Anesthesiology, 126(3), 507-521 (2017-01-04)
The authors have reported that antioxidative effects play a crucial role in the volatile anesthetic-induced neuroprotection. Accumulated evidence shows that endogenous antioxidation could be up-regulated by nuclear factor-E2-related factor 2 through multiple pathways. However, whether nuclear factor-E2-related factor 2 activation
Nan Chen et al.
Journal of cellular physiology, 235(10), 7204-7213 (2020-02-06)
Diabetic retinopathy (DR) is a leading cause of acquired blindness among adults. High glucose (HG) induces oxidative injury and apoptosis in retinal ganglion cells (RGCs), serving as a primary pathological mechanism of DR. MIND4-17 activates nuclear-factor-E2-related factor 2 (Nrf2) signaling
Zhenzi Bai et al.
Gut pathogens, 12, 22-22 (2020-04-30)
Emerging evidence closely links Enterovirus 71 (EV71) infection with the generation of reactive oxygen species (ROS). Excess ROS results in apoptosis and exacerbates inflammatory reactions. The Keap1-Nrf2 axis serves as an essential oxidant counteracting pathway. The present study aimed to

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.