Direkt zum Inhalt
Merck

EHU035381

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Florian Poetsch et al.
International journal of molecular sciences, 21(19) (2020-10-03)
In diabetes mellitus, hyperglycemia promotes the osteogenic transdifferentiation of vascular smooth muscle cells (VSMCs) to enhance medial vascular calcification, a common complication strongly associated with cardiovascular disease and mortality. The mechanisms involved are, however, still poorly understood. Therefore, the present
Jakob Voelkl et al.
The Journal of clinical investigation, 128(7), 3024-3040 (2018-06-12)
Medial vascular calcification, associated with enhanced mortality in chronic kidney disease (CKD), is fostered by osteo-/chondrogenic transdifferentiation of vascular smooth muscle cells (VSMCs). Here, we describe that serum- and glucocorticoid-inducible kinase 1 (SGK1) was upregulated in VSMCs under calcifying conditions.
Eneda Toska et al.
Cell reports, 27(1), 294-306 (2019-04-04)
The PI3K pathway integrates extracellular stimuli to phosphorylate effectors such as AKT and serum-and-glucocorticoid-regulated kinase (SGK1). We have previously reported that the PI3K pathway regulates estrogen receptor (ER)-dependent transcription in breast cancer through the phosphorylation of the lysine methyltransferase KMT2D
Nadeshda Schelski et al.
Pflugers Archiv : European journal of physiology, 471(6), 889-899 (2019-02-02)
The serum- and glucocorticoid-inducible kinase 1 (SGK1) is a key regulator of osteo-/chondrogenic transdifferentiation and subsequent calcification of vascular smooth muscle cells (VSMCs). The phenotypical transdifferentiation of VSMCs is associated with increased interleukin-18 (IL-18) levels and generalized inflammation. Therefore, the
Ferran Medina-Jover et al.
FEBS letters, 594(19), 3200-3215 (2020-08-09)
BMP9 is a cytokine involved in the maturation phase of the angiogenic process that signals through its serine/threonine receptor ALK1 and its coreceptor endoglin. In this paper, we explain how BMP9 directs the regulation of endothelial cell proliferation blockage while

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.