Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

Gesamtdokumentation anzeigen

EHU002721

Sigma-Aldrich

MISSION® esiRNA

targeting human ERN1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CACAGTGACGCTTCCTGAAACCTTGTTGTTTGTGTCAACGCTGGATGGAAGTTTGCATGCTGTCAGCAAGAGGACAGGCTCAATCAAATGGACTTTAAAAGAAGATCCAGTCCTGCAGGTCCCAACACATGTGGAAGAGCCTGCCTTTCTCCCAGATCCTAATGATGGCAGCCTGTATACGCTTGGAAGCAAGAATAATGAAGGCCTGACGAAACTTCCTTTTACCATCCCAGAATTGGTGCAGGCATCCCCATGCCGAAGTTCAGATGGAATCCTCTACATGGGTAAAAAGCAGGACATCTGGTATGTTATTGACCTCCTGACCGGAGAGAAGCAGCAGACTTTGTCATCGGCCTTTGCAGATAGTCTCTGCCCATCAACCTCTCTTCTGTATCTTGGGCGAACAGAATACACCATCACCATGTACGACACCAAAACCCGAGAGCTCCGGTGGAATGCCACCTACTTTGACTATGCGGCCTCACTGCCTGAGGACGACGTGGACTACAAGATGTCCCACTTTGTGTCCAATGGTGATGGGCTGGTGGTGACTGTGGACAGT

Ensembl | Human Hinterlegungsnummer

ENSG00000178607

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... ERN1(2081) , ERN1(2081)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Anne-Sophie Michallet et al.
PloS one, 6(10), e25820-e25820 (2011-10-27)
To determine whether the Unfolded Protein Response (UPR) sensors (PERK, ATF6 and IRE-1) can be targeted to promote death of Multiple Myeloma (MM) cells. We have knocked-down separately each UPR stress sensor in human MM cell lines using RNA interference
Qun Lai et al.
Yonsei medical journal, 54(6), 1407-1415 (2013-10-22)
To investigate the anti-apoptotic mechanism of leptin in non-small cell lung cancer. The influences of leptin on apoptosis were investigated, analyzing the mechanism that triggers growth of A549 cells. The effects of leptin on cell proliferation were examined by XTT
Xia Sheng et al.
EMBO molecular medicine, 7(6), 788-801 (2015-04-13)
The unfolded protein response (UPR) is a homeostatic mechanism to maintain endoplasmic reticulum (ER) function. The UPR is activated by various physiological conditions as well as in disease states, such as cancer. As androgens regulate secretion and development of the
K W Kim et al.
Oncogene, 29(22), 3241-3251 (2010-03-30)
As apoptosis defects limit efficacy of anticancer agents, autophagy has been proposed as a novel strategy for radiotherapy enhancement. We previously showed that caspase-3/7 inhibition induces autophagy and promotes radiosensitivity in vitro and in vivo. Therefore, we further investigated the
Amanda Crider et al.
Molecular neurobiology, 55(9), 7606-7618 (2018-02-13)
Impaired social interaction is a key feature of several major psychiatric disorders including depression, autism, and schizophrenia. While, anatomically, the prefrontal cortex (PFC) is known as a key regulator of social behavior, little is known about the cellular mechanisms that
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.