Skip to Content
Merck
All Photos(1)

Documents

EHU083751

Sigma-Aldrich

MISSION® esiRNA

targeting human VCAM1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTGAAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGTTTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTCGTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCAAGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAGTCAAAAGTGTAGCTAATGCTTGATATGTTCAACTGGAGACACTATTTATCTGTGCAAATCCTTGATACTGCTCATCATTCCTTGAGAAAAACAATGAGCTGAGAGGCAGACTTCCCTGAATGTATTGAACTTGGAAAGAAATGCCCATCTATGTCCCTTGCTGTGAGCA

Ensembl | human accession no.

ENSG00000162692

NCBI accession no.

NM_080682

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VCAM1(7412) , VCAM1(7412)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hai-Jian Sun et al.
Scientific reports, 6, 23596-23596 (2016-03-24)
Vascular smooth muscle cells (VSMCs) are indispensible components in foam cell formation. Salusin-β is a stimulator in the progression of atherosclerosis. Here, we showed that salusin-β increased foam cell formation evidenced by accumulation of lipid droplets and intracellular cholesterol content
Ryota Takahashi et al.
Scientific reports, 10(1), 21194-21194 (2020-12-05)
Pancreatic cancer is one of the malignant diseases with the worst prognosis. Resistance to chemotherapy is a major difficulty in treating the disease. We analyzed plasma samples from a genetically engineered mouse model of pancreatic cancer and found soluble vascular
Huilin Ye et al.
Cell death & disease, 9(5), 453-453 (2018-04-20)
Tumor-associated macrophages (TAMs) are frequently found near pancreatic cancer cells, but it is uncertain whether they are involved in pancreatic cancer progression and the Warburg effect. Here, we show that CCL18 secreted by TAMs facilitates malignant progression and induced a
Orawin Prangsaengtong et al.
Vascular medicine (London, England), 23(3), 201-211 (2018-04-10)
Lymphangiogenesis is the process of new vessel formation from pre-existing lymphatic vessels. The process mainly involves cell adhesion, migration, and tubule formation of lymphatic endothelial cells. Tumor-induced lymphangiogenesis is an important factor contributing to promotion of tumor growth and cancer
Cédric Ménard et al.
Stem cells (Dayton, Ohio), 38(1), 146-159 (2019-09-11)
Clinical-grade mesenchymal stromal cells (MSCs) can be expanded from bone marrow and adipose tissue to treat inflammatory diseases and degenerative disorders. However, the influence of their tissue of origin on their functional properties, including their immunosuppressive activity, remains unsolved. In
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service