Skip to Content
Merck
All Photos(1)

Documents

EHU072201

Sigma-Aldrich

MISSION® esiRNA

targeting human LONP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAGCAATGAGTCGGATGTGGTCGAGAGCCTGGATGAAATCTACCACACGGGGACGTTTGCCCAGATCCATGAGATGCAGGACCTTGGGGACAAGCTGCGCATGATCGTCATGGGACACAGAAGAGTCCATATCAGCAGACAGCTGGAGGTGGAGCCCGAGGAGCCGGAGGCGGAGAACAAGCACAAGCCCCGCAGGAAGTCAAAGCGGGGCAAGAAGGAGGCGGAGGACGAGCTGAGCGCCAGGCACCCGGCGGAGCTGGCGATGGAGCCCACCCCTGAGCTCCCGGCTGAGGTGCTCATGGTGGAGGTAGAGAACGTTGTCCACGAGGACTTCCAGGTCACGGAGGAGGTGAAAGCCCTGACTGCAGAGATCGTGAAGACCATCCGGGACATCATTGCCTTGAACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Olga Zurita Rendón et al.
Molecular and cellular biology, 38(20) (2018-08-01)
LONP1, an AAA+ mitochondrial protease, is implicated in protein quality control, but its precise role in this process remains poorly understood. In this study, we have investigated the role of human LONP1 in mitochondrial proteostasis and gene expression. Depletion of
Meng Zhao et al.
Theranostics, 11(4), 1845-1863 (2021-01-08)
Aims: Ischemia-reperfusion injury (IRI)-induced acute kidney injury (IRI-AKI) is characterized by elevated levels of reactive oxygen species (ROS), mitochondrial dysfunction, and inflammation, but the potential link among these features remains unclear. In this study, we aimed to investigate the specific
Shiyuan Huang et al.
American journal of physiology. Cell physiology, 319(6), C1020-C1028 (2020-09-17)
Myoblast differentiation is a crucial process for myogenesis. Mitochondria function as an energy-providing machine that is critical to this process, and mitochondrial dysfunction can prevent myoblasts from fusing into myotubes. However, the molecular mechanisms underlying the dynamic regulation of mitochondrial
Marie Lagouge et al.
PLoS genetics, 11(8), e1005423-e1005423 (2015-08-08)
We have studied the in vivo role of SLIRP in regulation of mitochondrial DNA (mtDNA) gene expression and show here that it stabilizes its interacting partner protein LRPPRC by protecting it from degradation. Although SLIRP is completely dependent on LRPPRC

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service