Skip to Content
Merck
All Photos(1)

Documents

EHU067301

Sigma-Aldrich

MISSION® esiRNA

targeting human TFCP2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAACCACACCTCAGGAAGCTCAGCAGTGGTTGCATCGAAATCGTTTTTCTACATTCACAAGGCTTTTCACAAACTTCTCAGGGGCAGATTTATTGAAATTAACTAGAGATGATGTGATCCAAATCTGTGGCCCTGCAGATGGAATCAGACTTTTTAATGCATTAAAAGGCCGGATGGTGCGTCCAAGGTTAACCATTTATGTTTGTCAGGAATCACTGCAGTTGAGGGAGCAGCAACAACAGCAGCAGCAACAGCAGCAGAAGCATGAGGATGGAGACTCAAATGGTACTTTCTTCGTTTACCATGCTATCTATCTAGAAGAACTAACAGCTGTTGAATTGACAGAAAAAATTGCTCAGCTTTTCAGCATTTCCCCTTGCCAGATCAGCCAGATTTACAAGCAGGGGCCAAC

Ensembl | human accession no.

ENSG00000135457

NCBI accession no.

NM_005653

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TFCP2(7024) , TFCP2(7024)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shi Wang et al.
Acta biochimica et biophysica Sinica, 48(12), 1085-1093 (2016-11-01)
Pancreatic cancer is an aggressive malignancy. The median survival rate remains low, indicating that the identification of novel biomarkers and therapeutic targets is critical. Here, we examined the role of microRNA-182 (miR-182) in pancreatic cancer development. Analysis of human pancreatic
Buch Lipi et al.
Experimental brain research, 236(11), 3015-3027 (2018-08-18)
Astrocytes perform several critical functions such as promoting neuronal maturation, neuronal survival, maintaining and supporting neurons and oligodendrocytes. Astrocytes participate in the formation of nodes of Ranvier. Recently, studies emphasizing on the role of astrocytes in regulating myelination by secreting
Kedarlal Sharma et al.
Journal of molecular neuroscience : MN, 65(3), 343-350 (2018-07-12)
MeCP2 (methyl-CpG binding protein 2), an epigenetic regulator, has been shown to regulate the function of neurons and glial cells. Our previous study has demonstrated that MeCP2 repress the myelin gene expression in rat oligodendrocytes but whether MeCP2 bind to
DongDong Tong et al.
Oncogenesis, 9(5), 56-56 (2020-06-03)
Methyl-CpG-binding protein 2 (MeCP2) facilitates the carcinogenesis and progression of several types of cancer. However, its role in breast cancer and the relevant molecular mechanism remain largely unclear. In this study, analysis of the Cancer Genome Atlas (TCGA) data that
Jiawei Zhou et al.
Cell death & disease, 8(2), e2597-e2597 (2017-02-10)
Mammalian folliculogenesis is a complex process in which primordial follicles develop into pre-ovulatory follicles, followed by ovulation to release mature oocytes. In this study, we explored the role of miR-144 in ovulation. miR-144 was one of the differentially expressed microRNAs
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service